Aspergillus versicolor (Vuillemin) Tiraboschi, anamorph (ATCC® 11730)

Strain Designations: QM 432 [ATCC 16020, CBS 245.65, DSM 1943, DSM 63301, IFO 30338, IMI 45554, MIT-1c]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Aspergillus versicolor (Vuillemin) Tiraboschi, anamorph
Strain Designations QM 432 [ATCC 16020, CBS 245.65, DSM 1943, DSM 63301, IFO 30338, IMI 45554, MIT-1c]
Application
Fungus resistance testing
Fungus resistance testing adhesives
Fungus resistance testing airborne equipment
Fungus resistance testing automotive components
Produces acetyl-xylan esterase
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAAAATGGTTGGACGTCGGCTGGCGCCCGGCCGGCCCTAAATCGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACACGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGGGGGACGACGACCCAACACACAAGCCGGGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCAGTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTGACTGATTTTATATTCAGACTCAGACTGCATCACTCTCAGGCATGAAGTTCAGTAGTCCCCGGCGGCTCGCCCCCGAGAGGGCTCCCCGCCGAAGCAACAGTGTTAGGTAGTCACGGG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCTCCGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCAGGGTGCCCGTGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGGCCTCGGGGTTCAGCCAGCATTCGTGCTGGTGTACTTCCCCGGGGCCGGGCCAGCGTCGGTTCGGGCGGCCGGTCAAAGGCCCCAGGAATGTATCGTCCTCCGGGACGTCTTATAGCCTGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCGTAATGGTTGCAAACGA

Name of Depositor QM
Chain of Custody
ATCC <-- QM <-- MIT-1c
Isolation
Cellophane gas mask, India
References

ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.

RTCA Environmental conditions and test procedures for airborne equipment -- Fungus resistance. Washington, DC:RTCA;RTCA DO-160C.

U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000

Khan AW, et al. Comparison of natural hemicellulose and chemically acetylated xylan as substrates for the determination of acetyl-xylan esterase activity in Aspergilli. Enzyme Microb. Technol. 12: 127-131, 1990.

Standard Specification for Cellulosic Fiber Loose-Fill Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 0739-05be1.

Standard Specification for Self-Supported Spray Applied Cellulosic Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1149-06e1.

Standard Test Method for Determining Fungi Resistance of Insulation Materials and Facings. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1338-00.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation