Rhodotorula mucilaginosa (Jorgensen) Harrison var. mucilaginosa, anamorph (ATCC® 66034)

Strain Designations: AmMS 232  /  Product Format: freeze-dried

Deposited As Rhodotorula rubra (Demme) Lodder, anamorph
Strain Designations AmMS 232
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format freeze-dried
Type Strain no
Preceptrol® yes
Morphology After 4 days on Emmons’ modification of Sabouraud’s agar at 25°C, colonies are pink, smooth, glossy. Cells are subglobose or ovoidal, single or in pairs, pseudohyphae are absent.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AGGATCATTAGTGAATATAGGACGTCCAACTTAACTTGGAGTCCGAACTCTCACTTTCTAACCCTGTGCACTTGTTTGGGATAGTAACTCTCGCAAGAGAGCGAACTCCTATTCACTTATAAACACAAAGTCTATGAATGTATTAAATTTTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAATACTTCAACCCTCCTCTTTCTTAATGATTGAAGAGGTGTTTGGTTTCTGAGCGCTGCTGGCCTTTACGGTCTAGCTCGTTCGTAATGCATTAGCATCCGCAATCGAACTTCGGATTGACTTGGCGTAATAGACTATTCGCTGAGGAATTCTAGTCTTCGGACTAGAGCCGGGTTGGGTTAAAGGAAGCTTCTAATCAGAATGTCTACATTTTAAGATTAGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

 

 

26S ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAATGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAGACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTCTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGCCTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGAC

Morphology After 4 days on Emmons’ modification of Sabouraud’s agar at 25°C, colonies are pink, smooth, glossy. Cells are subglobose or ovoidal, single or in pairs, pseudohyphae are absent.
Name of Depositor GJ De Leon
Cross References

Nucleotide (GenBank) : EU853846 ITS including 5.8S rRNA gene

References

MicroScan Yeast ID QC Set. Dade/Siemens.