Cryptococcus humicola (Daszewska) Golubev, anamorph (ATCC® 64676)

Strain Designations: LRA 229.03.85  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Candida humicola (Daszewska) Diddens et Lodder, anamorph
Strain Designations LRA 229.03.85
Application
quality control strain
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
    18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ACCTGCGGAAGGATCATTAGTGATTGCCCTTAGTGGCTAAAAACTATATCCCAAACACCTGTGAACTGTTGAATCGCGTCTTCGGATGTGATTCTTTTACAAACATTGTGTAATGAACGTCATAACATTATAAACAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTGTCATGATCTCTCAACCAATAGGGTTTCTTATTGGCTTGGATCTGGGTGTTGCCAGCTTTGTCTGGCTCGCCTTAAAGGAGTTAGCGAGTAAAGCTCTGTCGTCTGGCGTAATAAGTTTCGCTGGTGTAGACAGTGGTGGCGCACGCTTATAATCGCCTTCGGGC

Name of Depositor API System/bioMerieux
Cross References

Nucleotide (GenBank) : GU256753 ITS including 5.8S rRNA gene

References

API ID 32 C. bioMerieux.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation