Candida geochares (van der Walt et al.) Meyer et Yarrow, anamorph (ATCC® 36852)

Strain Designations: CBS 6870 [CCRC 22394, IFO 10278, NRRL Y-17073]  /  Product Format: freeze-dried

Deposited As Torulopsis geochares van der Walt et al., anamorph
Strain Designations CBS 6870 [CCRC 22394, IFO 10278, NRRL Y-17073]
Application
quality control strain
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology After 3 days in YM broth at 25°C, the cells are globose to subglobose, 3-5 µm, and occur singly or in pairs. After 14 days on cornmeal agar at 25°C, pseudohyphae are not present. Aerobic growth is white, butyrous, smooth and with an entire margin.
Sequenced Data

18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCCGTAGGTGAACCTGCGGAAGGATCATTTCTGAATCTTCTACACACAGTGACACGAACAAGTGACGCGCAGCGGCACTTGTGATTGCTTCCGGTTCGCCGGGCTTTAACAACAACCAAATTAATCTGACAACGAAAAACCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCAAAGCGCGATAGGTAATGCGAATTGCAGACGTGAGTCATTGAATCTTTGAACGCACATTGCGCCAGTTTACTGGCATACTGCGTTGAGCGTCGGCCTTCCTCCACAGGTAATGCTACTTTCAGTAGTTAAAGGCATGGAAATGCACCCGTTAGCAAAACGGTGCACACCACAAAAATTCGACCTCAGCGTAGTAAGATTACCCGCTGAACTTAAG


Large subunit ribosomal RNA gene, partial sequence.

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAATGGCGAATGAACAGGCAAAAGCTCAGATTTGAAACCCTCGGGATTGTAATCTGAAGACCTGGATTTGGCAGGCTGACCAAGTCTTCTGGAATGGAGCGCCATGGAGGGTGACAGCCCCGTAGCAGCAGCCATTGTAAATCCGGGTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATGCTCCATCTAAGGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAATGGAAGGCAATGAGGTGCGATTGAACCGGACGTTTGCGGGCAGGACAAAAGCGCAGGCCGCCTCGGCATTGCCTGCGTGCATACTGCCTCGCGGACTACCAGTTCTAACAACGCCTTATTGCAC

Morphology After 3 days in YM broth at 25°C, the cells are globose to subglobose, 3-5 µm, and occur singly or in pairs. After 14 days on cornmeal agar at 25°C, pseudohyphae are not present. Aerobic growth is white, butyrous, smooth and with an entire margin.
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- J.P. van der Walt
Isolation
Grassland soil; South Africa
References

van der Walt JP, et al. Torulopsis geochares and Torulopsis azyma, two new haploid species of ascomycetous affinity. Antonie van Leeuwenhoek 44: 97-104, 1978. PubMed: 566080

YT MicroPlate QC Set. Biolog.