Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® MYA-747)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: 9V-H70 [PIN+]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Saccharomyces cerevisiae Hansen, teleomorph
Classification Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae
Strain Designations 9V-H70 [PIN+]
Alternate State Candida robusta Diddens et Lodder
Application Transformation host for expression of yeast prions
Biosafety Level 1
Product Format frozen
Type Strain no
Genotype MATalpha ade2-1 SUQ5 SUP35-C kar1-1 leu2-3 leu2-112 ura3-52 his3 cyh(R) [psi-]
Preceptrol® no
Mating Type alpha
Morphology After 3 days on YEPD medium at 25°C, colony is off-white, smooth, butyrous and glossy. Cells are globose to ovoidal, single or in pairs, pseudohyphae absent.
Medium ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAG

 

 

D1D2 region of the 26S ribosomal RNA gene.

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC

Morphology After 3 days on YEPD medium at 25°C, colony is off-white, smooth, butyrous and glossy. Cells are globose to ovoidal, single or in pairs, pseudohyphae absent.
Name of Depositor MD Ter-Avanesyan
Special Collection NCRR Contract
Chain of Custody
ATCC <<--MD Ter-Avanesyan<<--V.V. Kushnirov
References

Kushnirov VV, et al. Prion properties of the Sup35 protein of yeast Pichia methanolica. EMBO J. 19: 324-331, 2000. PubMed: 10654931

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation