Rhizoctonia sp. (ATCC® MYA-4929)

Strain Designations: A3  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations A3
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Preceptrol® no
Comments Endophytic fungus demonstrated in vitro synthesis of silver nanoparticle when subjected to silver nitrate and silver sulfate.
Morphology On PDA medium at 25°C after 6 days, mycelium white, yellow, and reddish brown in concentric rings, velvety to cottony, dense. Reverse bright yellow. Hyphae some hyaline and some dematiacous, guttulate.
Medium ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AGTTGGTTGTCGCTGGCCCCTTCACCGGGGCATGTGCACGCCTCCTCTATTCATCCACACACACCTGTGAACTTGTGAGACGGATAGTAGCCCTTTCGGGGGCGAGGTCCGTCTGCTATACATAAACTCCAATATATAAATTTGAATGTAATTTGATGTAACACATCTTTAAACTAAGTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCTCGGAGCATGCCTGTTTGAGTATCATGAAATCCTCAAAATAAATCTTTTGTTCATTCGATTGATTTTATTTTGGACTTGGAGGTCTGCAGATTCACGTCTGCTCCTCTTAAATGTATTAGCTGGATCTCAGTGAACTCGGTTCCACTCGGCGTGATAAGTATCACTCGCTGAGGACACTGTAAAAGGTGGCCGGGGTTGCAGACGAACCGCTTCTAATCGTCCATTCACTTGGACAATTTATTTATGATCTGATCTCAAATCA


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCGGTTTACCGTCCGAGTTGTAGTCTAGAGAAGCATCATCTACGCTGGACCATGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGGACTCCCAGTGTTCTGTGTTGTGCTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAGAGAGAGTTAAACAGTACGTGAAATTGTTGAAATGGAAACGCTTGAAGTCAGTCGCGTTCTCTGGGATTCAGCCTTGCTTTTGCTTGGTGCATTTCCTAGTCTACGGGCCAGCATGGATTTTGACCGTTGGAAAAGGGCTGGGGGAATGTGGCACTTTCGGGTGTGTTATAGCCCCCTGTCGCATGCATCGGTTGGGATCGAGGACCTCAGTGCACGCTTCGGTTGTGCTTTGATGCTGGCGTAATGGCTTTAAACGA

Morphology On PDA medium at 25°C after 6 days, mycelium white, yellow, and reddish brown in concentric rings, velvety to cottony, dense. Reverse bright yellow. Hyphae some hyaline and some dematiacous, guttulate.
Name of Depositor D Raudabaugh
Chain of Custody ATCC <-- D Raudabaugh <-- AN Miller
Isolation Conocephalum conicum, Clinton County, Pennsylvania, USA.
References

Raudabaugh DB, et al. Synthesis of silver nanoparticles by a bryophilous Rhizocotonia species. Nanomater. Nanotechnol. 3: Art. 2, 2013.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation