Fusarium verticillioides (Saccardo) Nirenberg (ATCC® MYA-4922)

Strain Designations: FGSC 7600 [A-00149, M3125]  /  Product Format: frozen

Deposited As Fusarium verticilliodes
Strain Designations FGSC 7600 [A-00149, M3125]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Genotype VCG A7
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type mating type A-
Comments

Genome sequencing strain (Broad Institute, USA).

Morphology After 4 days on potato dextrose medium at 25°C, colony is white, cottony, tinged with purple. Microconidia abundant, single-celled, oval, formed in false heads on monophialides. Macroconidia present, sickle-shaped to straight, 3-5 septate.
Medium Medium 200: YM agar or YM broth
Medium 323: Malt agar medium
Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGACTCGCGAGTCAAATCGCGTTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


Partial caM gene for calmodulin.

TCTTTGTAAGCTATCCCCTTTGTTTCGCCGCCTTGCCTAGCCGGGTCTTGTGAGAAGCTGTCGCTAACCTCTTTATGTAGGACAAGGATGGCGATGGTGAGTGATGCTCCCCTTCCTGCGATGTTTCTCCGTTGGCCCCGTGCGAAACCCAAATCGATCCAACAAAGCATGCATCAGACCACTATAATCCTTTACATCTCTGTCTATGCGATATTCTTAAATCGAAAACATGAGCTAAACGCCTCGCTCTAGGCCAGATTACCACCAAGGAGCTCGGTACCGTTATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCTGAGCTTCAGGACATGATCAACGAGGTTGACGCTGACAACAACGGCACCATCGACTTTCCTGGTTCGTAGTATCCCAAGACGATTATAGGACGGTCGAGTACTAACCATTAGGTAAAGAGTTCCTTACCATGATGGCC

Morphology After 4 days on potato dextrose medium at 25°C, colony is white, cottony, tinged with purple. Microconidia abundant, single-celled, oval, formed in false heads on monophialides. Macroconidia present, sickle-shaped to straight, 3-5 septate.
Name of Depositor FGSC
Chain of Custody ATCC <-- FGSC <--Leslie JF
Isolation Maize, Visalia, CA, USA
Cross References

Complete Genome (GenBank) : AAIM00000000 Fusarium verticillioides 7600, whole genome shotgun sequencing project

References

Ma LJ, et al. Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 464: 367-373, 2010. PubMed: 20237561

Xu JR, et al. Electrophoretic karyotypes distinguish the biological species of Gibberella fujkuroi (Fusarium section Liseola). Mol. Plant-Microbe Interact. 8: 74-84, 1995.