Dictyostelium angelicum Cavender et al. (ATCC® MYA-4866)

Strain Designations: 38BO  /  Product Format: frozen

Classification Dictyosteliales
Strain Designations 38BO
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Genotype Not available
Preceptrol® no
Comments Grown in two-member culture with Escherichia coli (ATCC 23437)
Morphology On LY agar after 10 days at 20°C, Sorocarps erect to prone, solitary to loosely clustered and variable in height.
Sequenced Data
18S ribosomal RNA gene, partial sequence:

GAAACTGCAGACGGCTCATTACAACAGTGATAAACTAATAGAGTTTCGGGTCTAACCTACATGGATATCCGCAGTAAATCGGGGCTAATACATACAAACGAGGGGTGACTGTTTACGGAAGCTCCGCGATTATTAGTCTAGCCAATACCCGCAAGGGTTTTGTGGTGAAACCGAATAATATTGCAGATCGAAATCTGATTTCGACAATTCTATTGTGTCACTGCCCTATCAACTTTCGATGGTACGGTATTGGCCTACCATGGTTGTAACGGGTAACGGAGAATTAGGGTTCGATTCCGGAGAGGGCGCCTGAGAAATGGCGACCACTTCTACGGAAGGCAGCAGGCGCGCAAATTACTCAATCCCAATACGGGGAAGTAGTGACAATAAATATTAATGCCTATTCGTTTTTCGAAAGGTAATTAAAATGGGTACAAATTAAATCCATTAACTAATACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCATATACTAAAGTTGTTGCGGTTAAAAAGCTCGTAGTTGAAACTAAATTTGCATTGGGTCAAAGTTTCTAGCCACTTTGGTGGTTACGAAATTCCAGTGCATTTTTTTAAATCTGCCCTTAAAGCCTCTACTTTGTAGTTGGTTTTCTTGGGTACTTCACTGTGAGAAAATTGTGGTGTTTAAAGCGGGCGTCTCGCCTGATCTTTTGCAGCATGGTATGATAAAACATGACATTTTGTGCAATTGGTTGCATTTAAAGTGTAATGATTAATAGGGATGGATGGGGGTGTTCATATTGGTGGGCGAGAGGTGAAATTCGTTGACCCTATCAAGATGAACTTCTGCGAAAGCATTCATCAAATACTTCCCCATTAATCAAGAACGAAAGTTTGGGGATCAAAGACGATCAGATACCGTCGTAGTCCAAACTATAAACTATGTCGACCAGGGATCGGTTAATATTTTTTAAAAATTTACTCGGCACCTTGTGAGAAATCATGAGTGTTTAGATTCTGGGGGGAGTATGGTCGCAAGTCTGAAACTTAAAGGAATTGACGGAAGGGCACACAATGGAGTGGAGCCTGCGGCTTAATTTGACTCAACTCGGGAAAACTTACCAAGCTAAGATATAGTAAGGATTGACAGACTAAAAGATTTTTCATGATTCTATAAGTGGTGGTGCATGGTCGTTCTTAGTTGGTGGAGCAATCTGTCTGGTCAATTCCGATAACGGACGAGATCTCGACCTGCTAACTAGTAGTACTTATTCGGTCGATATGAGTGAAGGCTCTCAGGGAGTAAGTTGTGCGTCGAAAGGTGTATGACACTTCGGGGGGTTTGTAACTTGACCAGATATGTACGATTTTAAAAACTTCTTAGAGGGACTACCTGTGGCAAACAGGGGGAAGTTCGAGGCAATAACAGGTCTGTGATGCCCTTAGATACCTTGGGCCGCACGCGCGCTACAATGTAATAGGCAAAAAGCTCTCCTGGTCCGGAAGGATTGGGTAATCATATGAATTTATTACGTAACTGGGCTTGATCTTTGTAATTATTGATCATCAACGAGGAATTCCTTGTAAGCGCAAATCATTACTTTGCGCTGAATATGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCCTACCGATCGAATGATACGGTAAAGCCAACGGATAAGATTCTGTAGCAATACGTGAATTTTAAAAGTTGTTTAAATCTCATTGT

Morphology On LY agar after 10 days at 20°C, Sorocarps erect to prone, solitary to loosely clustered and variable in height.
Name of Depositor J.C. Landolt
Chain of Custody ATCC <--J.C. Landolt; Shepherd University
Isolation Soils and leaf mold collected from seasonal rain forest of southern Belize (Bladen Preserve), Belize.
References

Cavender JC, et al. Ten new small dictyostelids from seasonal rain forests of Central America. Mycologica 105(3): 610-635, 2013.