Dictyostelium simplex Cavender et al. (ATCC® MYA-4860)

Strain Designations: OH 598  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Dictyosteliales, Dictyostelium
Strain Designations OH 598
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology On LY agar after 10 days at 20°C, Sorocarps solitary erect solitary to clustered and variable in height.
Sequenced Data
18S ribosomal RNA gene, partial sequence:

GAAACTGCAGACGGCTCATTACAACAGTGATAAACTAATAGAGTTTCGGGTCTAACCTACCTGGATATCCGCAGTAAATCGGGGCTAATACATACAAACGAGGGGTGACTGTTTACGGGAGCTCCGCGATTATTAGTCTAGCCAATACCCGCAAGGGTTTTGTGGTGAAACCGAATAATATTGCAGATCGAAATCTAATTTCGACAATTCTATTGTGTCACTGCCCTATCAACTTTCGATGGTACGGTATTGGCCTACCATGGTTGTAACGGGTAACGGAGAATTAGGGTTCGATTCCGGAGAGGGCGCCTGAGAAATGGCGACCACTTCTACGGAAGGCAGCAGGCGCGCAAATTACTCAATCCCAATACGGGGAAGTAGTGACAATAAATATTAATGCCTATTCGTTTTTCGAAAGGTAATTAAAATGGGTACAAATTAAATCCCTTAACTAATACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCATATACTAAAGTTGTTGCGGTTAAAAAGCTCGTAGTTGAAACTAAATTTGTATTGGGTCCAAGTTCCTAGCCACTTTGGTGGTTACGGAATTCCAGTGCATTTTTTTAAACCTGCCCTTAAAGCCTCTACTTTGTAGTTGGTTTTCTTGGGTACTTCACTGTGAGAAAATTGTGGTGTTCAAAGCGGGCGTCTCGCCTGATCTTTTGCAGCATGGTATGATAAAACATGACATTTTGTGCAATTGGTTGCATTTAAGTGTAATGATTAATAGGGATGGATGGGGGTGTTCATATTGGTGGGCGAGAGGTGAAATTCGTTGACCCTATCAAGATGAACTTCTGCGAAAGCATTCATCAAATACTTCCCCATTAATCAAGAACGAAAGTTTGGGGATCAAAGACGATCAGATACCGTCGTAGTCCAAACTATAAACTATGTCGACCAGGGATCGGTTAATATTTTTTAAAAATTTACTCGGCACCTTGTGAGAAATCATGAGTGTTTAGATTCTGGGGGGAGTATGGTCGCAAGTCTGAAACTTAAAGGAATTGACGGAAGGGCACACAATGGAGTGGAGCCTGCGGCTTAATTTGACTCAACTCGGGAAAACTTACCAAGCTAAGATATAGTAAGGATTGACAGACTAAAAGATTTTTCATGATTCTATAAGTGGTGGTGCATGGTCGTTCTTAGTTGGTGGAGCAATCTGTCTGGTCAATTCCGATAACGGACGAGATCTCGACCTGCTAACTAGTAGTACTTATTCGGTCGATATGAGTGAAGGCTCTCAAGGAGTAAGTTGTGCGTCGCAAGGTGCATGACACTTCGGGGGGTTTGTAACTTGATCAGATATGTACGATTTTAAAAACTTCTTAGAGGGACTACCTGTGGCAAACAGGGGGAAGTTCGAGGCAATAACAGGTCTGTGATGCCCTTAGATACCTTGGGCCGCACGCGCGCTACAATGTAATAGGCAAAAAGCTCTCCTGGTCCGGAAGGATTGGGTAATCATATGAATTTATTACGTAACTGGGCTTGATCTTTGTAATTATTGATCATCAACGAGGAATTCCTTGTAAGCGCAAATCATTACTTTGCGCTGAATATGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCCTACCGATCGAATGATACGGTAAAGCCAACGGATAAGATTCTGTAGCAATACGTGAATTTTAAAAGT

Morphology On LY agar after 10 days at 20°C, Sorocarps solitary erect solitary to clustered and variable in height.
Name of Depositor J.C. Landolt
Chain of Custody ATCC <-- J.C. Landolt; Shepherd University <-- J.C. Cavender
Isolation Soils collected from the semi-green rain forest of Tikal, Guatemala.
References

Cavender JC, et al. New small dictyostelids from seasonal rainforests of Central America. Mycologia 105: 610-635, 2013. PubMed: 23396155

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation