Cylindrocarpon sp. (ATCC® MYA-283)

Strain Designations: rn2c1 [ILLS 54720]  /  Product Format: frozen

Deposited As Fusarium oxysporum Schlechtendahl, anamorph
Strain Designations rn2c1 [ILLS 54720]
Application
potential biological control agent against Verticillium wilt disease
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments The DNA sequences of ITS, D1D2 and RPB1 regions of MYA-283 differ from the type strain of Cylindrocarpon olidum ATCC 16548 (CBS 215.67) by mismatches of 4, 3 and 9 nucleotide positions, respectively.
Morphology After 6 days on Potato dextrose medium at 25°C, colony is flat, white to buff, reverse orange-brown. Macroconidia hyaline, fusiform, slightly curved 3-5 septate.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 335: Potato carrot agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTACGTTGCTTCGGCGGACCACCCCAACCCCCTCGGGGCGAGGGGCCGCCAGAGGACCCAAAACCCAACTGTTTTTTCCGTAACGAAACCTATTCTGAGTGGAATTATTAAATAAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCGGGCTCGGTGTTGGGGATCGGCACAAGGCGGAGGCTCCCCCGGGAGCCCCCCCGCCCGCCGTCCCCCAAATGCAGTGGCGGTCACGTCGCGGCCCCCCGTGCGTAGTAGCAACACCTCGCACCGGAGCCCGTCGTGCCCACGCCGTAAAACCCCCGACTTTTACAAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAG

 

D1/D2 region of 28S ribosomal RNA gene; GenBank number: KC585414

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCAAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGCGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGATTATGACCAGACTTGGGCCTGTTTGATCAGCTTGGGTTCTCCCGGGTGCACTCTCTCAGGCTCAGGCCAGCATCAGTTCGTCGCGGGGGACAAAGGTCGCGGGAATGTAGCTCCCCTCGGGGAGTGTTATAGCTCGCTTCGCAATACCCTGCCTCGGACTGAGGTTCGCGCATCTtGCAAGGATGCTGGCGTAATGGTCATCATCGAC
Morphology After 6 days on Potato dextrose medium at 25°C, colony is flat, white to buff, reverse orange-brown. Macroconidia hyaline, fusiform, slightly curved 3-5 septate.
Name of Depositor E Grunden
Isolation
Microsclerotia of Verticillium daliae, Rutan Woods, Ogden, IL, USA
Cross References

Nucleotide (GenBank) : AF176656 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : KC585414 Large subunit ribosomal RNA gene; partial sequence

References

Eric Grunden, personal communication

Chaverri P et al. Delimitation of Neonectria and Cylindrocarpon (Nectriaceae, Hypocreales, Ascomycota) and related genera with Cylindrocarpon-like anamorphs. Studies in Mycology 68:57-78, 2011. PubMed: 21523189