Mucor racemosus Fresenius, teleomorph (ATCC® 204008)

Product Format: frozen

Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
termite mound soil eaten by chimpanzees
Morphology After 5 days on Potato dextrose medium at 25°C, colony is low, powdery, dark grey; reverse uncolored. Sporangia are grey, ovoid, columellate, stipes pigmented. Sporangiospores are grey, smooth-walled, irregularly shaped.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AGGATCATTAAATAATCAATAATTTTGGCTTGTCCATCATTATCTATTTACTGTGAACTGTATTATTACTTGACGCTTGAGGGATGTTCCAGTGCTATAAGGATAGGCATTGGAAATGTTAACCGAGTCATAATCAAGCTTAGGCTTGGTATCCTATTATTATTTACCAAAAGAATTCAGAATTAATATTGTAACATAGACGTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTGTTTCAGTATCAAAACAAACCCTCTATCCAACATTTGTTGAATAGGATGACTGAGAGTCTCTTGATCTTTTGATCTCGAACCTCTTGAAATGTACAAAGGCCTGATCTTGTTTAAAAGCCTGAACTTTTTTTTAATATAAAGAGAAGCTCTTGCGGTAAACTGTGCTGGGGCCTCCCAAATAACACATCTTTAAATTTGATCTGAAATCAGGTGGGATTACCCGCTGAACTTAAG

 

 

RNA polymerase II largest subunit (RPB1) gene, partial cds.

ATTGGCTAAACCCTGTCTATCATATTGGTAAGTGTGATGATATACTATATAGATGATGACATGAAGCTCATGTGTCTTGCTGTAGGTTTCTTGACAAAAGTAAAAAAGATCCTTGAATGTGTTTGTTTCCATTGTTCCAAGCTCAAAGTCGATGAAGTATGTATCTACCATTGAAAATAGCGTGTTTTTATACTCATTATTGCCTCTAGACAAATCCTCGTTTCGAAAGAGCAAAGAAAATTACCGACTCAAAAGCTAAACTGCGTGCAGTATGGGACCTCGCCAAAGCCAAGATGACTTGTGAAGGCAGTGACGAAGCTGAAGGTGGTTTAGAAGAAAAGGAAGAGTTTGACAATGGCAAGCGCAAGAGTACACACGGCGGCTGCGGCTACAAACAACCTCTCATTCGCAAGGATGGCTTGAAATTGTACGCTCAGTTTCGTGCTAGTCCAGGAGATGTAAGTAGTGGTTGAGAGTTTTATGGTATTCATCGAGTTAACAGACAACCACATTAGGACTCTGGCAATGAAGGAAGACAACAGCTGACTGCTGCCAAAGTACTGCAAATCCTCAAGAACATTTCTGACAAGGATATTCGTGATATGGGCTTATCTGAAGAGTTTGCTCGCCCTGAATGGATGATTACAACTGTCTTACCTGTGCCTCCACCTCAAGTGCGTCCCTCTATTCAAATGGATGGTACCAGTCGCGGTGAAGATGATTTGACTCACAAATTGTCTGACGTTCTCAAGGCAAATGGCAATGTAAAGCGTTGTGAATCAGAAGGTGCTCCCGTACACGTTGTTCAAGAATTTGAGCAGCTCTTGCAGGTTTGTTAATATTGAATTGGATTGATTGATCCGTATTTTTTATTAAATACATATGCAACACACAGTTCCATATTGC

Morphology After 5 days on Potato dextrose medium at 25°C, colony is low, powdery, dark grey; reverse uncolored. Sporangia are grey, ovoid, columellate, stipes pigmented. Sporangiospores are grey, smooth-walled, irregularly shaped.
Name of Depositor L Ketch
Isolation
soil from mound of termites, Odontotermes sp., Mahale Mountains National Park, Tanzania
References

Laurie Ketch, personal communication