Cladosporium cladosporioides (Fresenius) de Vries, anamorph (ATCC® 201654)

Strain Designations: ND89-19  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Pyrenophora teres (Diedicke) Drechsler, teleomorph
Strain Designations ND89-19
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Highly virulent
Morphology On V8 medium at 20°C after 4 days, mycelium white becoming olive green, velutinous, semi-appressed. Reverse dark green to black. Hypahe dematiacous, guttulate. Conidia brownish green, smooth, both globose to lemon-shaped, 3.75-7.5 X 2.5-3.75 µm, and elongated ellipsoidal, 8.75-15 X 2.5-3.75 µm.
Medium Medium 343: V8 juice agar
Growth Conditions
Temperature: 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACAAGTGACCCCGGTCTTACCACCGGGATGTTCATAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCTCTAGTAACGGCGAGTGAAGCAGCAATAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGTAGAGGATGCTTCTGAGTAACCACCGACCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGCGGTCGGAAAGGTGCTCTATACGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGGGATTGCAACCAGACTTGCTCGCGGTGTTCCGCCGGTCTTCTGACCGGTCTACTCGCCGCGTTGCAGGCCAGCATCGTCTGGTGCCGCTGGATAAGACTTGAGGAATGTAGCTCCCTCGGGAGTGTTATAGCCTCTTGTGATGCAGCGAGCGCCGGGCGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTCGTAATCCG

Morphology On V8 medium at 20°C after 4 days, mycelium white becoming olive green, velutinous, semi-appressed. Reverse dark green to black. Hypahe dematiacous, guttulate. Conidia brownish green, smooth, both globose to lemon-shaped, 3.75-7.5 X 2.5-3.75 µm, and elongated ellipsoidal, 8.75-15 X 2.5-3.75 µm.
Name of Depositor BJ Steffenson
Isolation
Barley leaves, Hordeum vulgare, Wales, ND
References

Steffenson BJ, et al. Genetics of seedling and adult plant resistance to net blotch (Pyrenophora teres f. teres) and spot blotch (Cochliobolus sativus) in barley. Theor. Appl. Genet. 92: 552-558, 1996.

Brian J Steffenson, personal communication

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation