Aspergillus amstelodami (Mangin) Thom et Church, anamorph (ATCC® 1001)

Alternate State: Eurotium amstelodami Mangin, teleomorph  /  Strain Designations: 4013 [NRRL 92]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 4013 [NRRL 92]
Alternate State Eurotium amstelodami Mangin, teleomorph
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Intended Use
Preceptrol® no
Morphology After 7 days on Blakeslee’s malt extract medium at 25°C, colonies are flat, powdery dark green or yellow; reverse uncolored. Cleistothecia globose, yellow. Asci hyaline, with 8 ascospores. Ascospores hyaline, lenticular, with longitudinal flange. Conidial heads radiate, vesicles pyriform, uniseriate. Conidia globose, rough-walled.
Medium ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
Partial caM gene for calmodulin

TCTTCGTAAGTGCGCTGGCCATCTCCATGTGGCATTTTCCCCGTCGAACGTCGAGGACAGTGAACTGACCATGATTTTTGCATTTCTACAGGACAAGGATGGCGATGGTTAGTGATCCCGCTCTACTCTATATTCAATGTCTCTTTTACCCCACCATTCGATTGGCTCCGACCGTGATATCATATTCGCTGTTGAAATAATGCTCTTCCGTTACGACATGATACTGATGTATCTTCGCGACTACAGGCCAGATCACCACCAAGGAGCTGGGTACCGTTATGCGCTCGCTGGGCCAGAACCCTTCCGAGTCGGAGTTGCAGGACATGATCAATGAGGTTGACGCTGACAACAACGGCACCATCGATTTCCCTGGTATGCGATCGTCCCGACATAAAACGTTCTGTAACATGATAGGCGATTCTGACCCAAATAGAATTCCTTACCAT

Morphology After 7 days on Blakeslee’s malt extract medium at 25°C, colonies are flat, powdery dark green or yellow; reverse uncolored. Cleistothecia globose, yellow. Asci hyaline, with 8 ascospores. Ascospores hyaline, lenticular, with longitudinal flange. Conidial heads radiate, vesicles pyriform, uniseriate. Conidia globose, rough-walled.
Name of Depositor C Thom
Chain of Custody
ATCC <-- C Thom <-- Brewster
Isolation Moldy ham
Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation