lambda203 (ATCC® 65874)

Organism: Homo sapiens, human  /  Clone Type: Clone  /  Depositors: IB Dawid, P Bray

Permits and Restrictions

View Permits

Designations lambda203
GenBank Number

M88362

Species Homo sapiens, human
Depositors IB Dawid, P Bray
Applications
The predicted product size is (bp): 147. The observed product size is (bp): 147.
Vector
Construct size (kb): 47.0
Insert
DNA: genomic
Insert lengths(kb): 16.0
Tissue: placenta
Gene product: zinc finger protein bcl-6( zinc finger protein 51, B-cell CLL/lymphoma-6) [ZNF51]
Insert Size (kb) 16.0
Biosafety Level 1
Shipping Information Distributed: freeze-dried bacteria-free lysate
Comments
Restriction digests of the clone give the following sizes (kb): EcoRI--22.6, 10.0, 7.6, 6.2, 2.5; EcoRI/HindIII--22.6, 10.0, 5.6, 2.8, 2.5, 2.2, 0.47.
Verified to contain the correct insert sequence using the following oligonucleotides (5'-3'): CCTCCGTGCCCATGTGCTTATCCAC and CTCAAGAGGCTTACGTACATGG.
The predicted product size is (bp): 147. The observed product size is (bp): 147.
References

Lichter P, et al. Clustering of C2-H2 zinc finger motif sequences within telomeric and fragile site regions of human chromosomes. Genomics 13: 999-1007, 1992. PubMed: 1505991

Product Sheet
Product Sheet
Product Sheet