lambda90 (ATCC® 65862)

Organism: Homo sapiens, human  /  Clone Type: Clone  /  Depositors: IB Dawid, P Bray

Permits and Restrictions

View Permits

Designations lambda90
GenBank Number

M77172

Species Homo sapiens, human
Depositors IB Dawid, P Bray
Applications
The predicted product size is (bp): 247. The observed product size is (bp): 250.
Vector
Construct size (kb): 45.0
Insert
DNA: genomic
Insert lengths(kb): 14.0
Tissue: placenta
Gene product: zinc finger protein 22( KOX 15) [ZNF22]
Insert Size (kb) 14.0
Biosafety Level 1
Shipping Information Distributed: freeze-dried bacteria-free lysate
Comments
Restriction digests of the clone give the following sizes (kb): EcoRI--22.6, 12.5, 6.2, 3.8, 1.95, 1.60; EcoRI/HindIII--22.6, 12.5, 4.0, 3.0, 1.95, 1.60 (doublet), 0.44, 0.26.
Verified to contain the correct insert sequence using the following oligonucleotides (5'-3'): CGGTGTTTCAGCCAGAGCTCCCAC and CCTATACTTAACGGAGGCCAGCCAC.
The predicted product size is (bp): 247. The observed product size is (bp): 250.
References

Bray P, et al. Characterization and mapping of human genes encoding zinc finger proteins. Proc. Natl. Acad. Sci. USA 88: 9563-9567, 1991. PubMed: 1946370

Lichter P, et al. Clustering of C2-H2 zinc finger motif sequences within telomeric and fragile site regions of human chromosomes. Genomics 13: 999-1007, 1992. PubMed: 1505991

Product Sheet
Product Sheet
Product Sheet