Gibellulopsis nigrescens (ATCC® 60645)

Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Acremonium alternatum Link : Fries, anamorph
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Hyperparasite of Sphaerotheca fuliginea
Conidiogenesis is somewhat similar to that of Acremonium spp.
Morphology Colonies on Potato dextrose agar after 7 days at 25°C whitish, finely floccose with cream-colored reverse later becoming dark grey, mainly in reverse. Conidia hyaline, smooth-walled, elongated-ellipsoidal sometimes with two inconspicuous guttules. Chlamydospores grey-brown, smooth-walled, single or in short chains.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

CTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTACTATAACTCATAACCCTTTGTGAACCTTCATACCTGTTGCTTCGGCGGCGCGCCTCTCGGGGCGTGCCCGCCGGCATTATCAGAATCTCTGTTCGAACCCGACGATACTTCTGAGTGTTCTAAGCGAACTGTTAAAACTTTCAACAACGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATGGCGCCTTCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCCGTGGCCCGGCGTTGGGGACCTGCCCAGGCAGTCCCCGAAAACCAGTGGCGGACCCGACGGGCCCTTCCTTTGCGTAGTAACATCTGCCTCGCATCGGGAGCCCCCGGGCTATCCGGCCTCTAAACCCCCCTCAAGCCCGCTCCGGCGGCACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTACGGGTTCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTAGGACACCCAGCCCGTGTGAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAACGGGAGGTATACTCCTTCCAAGGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCTACCAGACATGGGTTCGGCGGTTCAACCGGGGCCACGCCCCGGGGCACTCCGCCGGCCCAGGCCAGCATCAGCTTTCCGTCGGGGGCAAAGGCGTCGGGAATGTGGCTCTCCTTCGGGGGAGTGTTATAGCCCGGCGTGTCATACCCTTCGGGGGGCTGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTAGCTAGTGAC

Morphology Colonies on Potato dextrose agar after 7 days at 25°C whitish, finely floccose with cream-colored reverse later becoming dark grey, mainly in reverse. Conidia hyaline, smooth-walled, elongated-ellipsoidal sometimes with two inconspicuous guttules. Chlamydospores grey-brown, smooth-walled, single or in short chains.
Name of Depositor NE Malathrakis
Isolation
Thallus of Sphaerotheca fuliginea on cucumber, Crete.
References

. . J. Plant Dis. Prot. 92: 509-515, 1985.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation