Gibellulopsis nigrescens (ATCC® 60645)

Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Acremonium alternatum Link : Fries, anamorph
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Hyperparasite of Sphaerotheca fuliginea
Conidiogenesis is somewhat similar to that of Acremonium spp.
Morphology Colonies on Potato dextrose agar after 7 days at 25°C whitish, finely floccose with cream-colored reverse later becoming dark grey, mainly in reverse. Conidia hyaline, smooth-walled, elongated-ellipsoidal sometimes with two inconspicuous guttules. Chlamydospores grey-brown, smooth-walled, single or in short chains.
Medium Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

CTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTACTATAACTCATAACCCTTTGTGAACCTTCATACCTGTTGCTTCGGCGGCGCGCCTCTCGGGGCGTGCCCGCCGGCATTATCAGAATCTCTGTTCGAACCCGACGATACTTCTGAGTGTTCTAAGCGAACTGTTAAAACTTTCAACAACGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATGGCGCCTTCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCCGTGGCCCGGCGTTGGGGACCTGCCCAGGCAGTCCCCGAAAACCAGTGGCGGACCCGACGGGCCCTTCCTTTGCGTAGTAACATCTGCCTCGCATCGGGAGCCCCCGGGCTATCCGGCCTCTAAACCCCCCTCAAGCCCGCTCCGGCGGCACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCCTTCGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTACGGGTTCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTAGGACACCCAGCCCGTGTGAAGCTCCCTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAACGGGAGGTATACTCCTTCCAAGGCTAAATACCGGCTGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTCAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTCGCTACCAGACATGGGTTCGGCGGTTCAACCGGGGCCACGCCCCGGGGCACTCCGCCGGCCCAGGCCAGCATCAGCTTTCCGTCGGGGGCAAAGGCGTCGGGAATGTGGCTCTCCTTCGGGGGAGTGTTATAGCCCGGCGTGTCATACCCTTCGGGGGGCTGAGGTACGCGCTTCTGCAAGGATGCTGGCGTAATGGTAGCTAGTGAC

Morphology Colonies on Potato dextrose agar after 7 days at 25°C whitish, finely floccose with cream-colored reverse later becoming dark grey, mainly in reverse. Conidia hyaline, smooth-walled, elongated-ellipsoidal sometimes with two inconspicuous guttules. Chlamydospores grey-brown, smooth-walled, single or in short chains.
Name of Depositor NE Malathrakis
Isolation
Thallus of Sphaerotheca fuliginea on cucumber, Crete.
References

. . J. Plant Dis. Prot. 92: 509-515, 1985.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation