Candida dubliniensis Sullivan et al., anamorph (ATCC® MYA-646)

Strain Designations: CBS 7987 [ATCC MYA-178, CD 36, NCPF 3949, NRRL Y-17841]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CBS 7987 [ATCC MYA-178, CD 36, NCPF 3949, NRRL Y-17841]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Sanger Institute, UK).
mitochondrial genome sequenced strain
Morphology After 3 days at 25°C colonies white to cream-colored, glistening, soft and smooth.  Cells are globose to ovoidal.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TTTGCTTAATTGCACCACATGTGTTTTGTTCTGGACAAACTTGCTTTGGCGGTGGGCCCCTGCCTGCCGCCAGAGGACATAAACTTACAACCAAATTTTTTATAAACTTGTCACGAGATTATTTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCCCTAGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGATGATAGTGGTATAAGGCGGAGATGCTTGACAATGGCTTAGGTGTAACCAAAAACATTGCTAAGGCGGTCTCTGGCGTCGCCCATTTTATTCTTCAAACTTTGACCTCAAATCAGGTAGGA


D1D2 region of the 26S ribosomal RNA gene

ACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGGCCCGGGTCTATGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCAAGTTACTCTTTCGGGGGTGGCCTCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGTAGGATAATGGCGGGGGAATGTGGCACGACTTTGGTTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATG

Morphology After 3 days at 25°C colonies white to cream-colored, glistening, soft and smooth.  Cells are globose to ovoidal.
Name of Depositor SA Meyer
Special Collection NCRR Contract
Chain of Custody
ATCC <-- SA Meyer <-- CBS 7987 <-- D.C. Coleman CD 36
Isolation
Oral cavity of HIV-infected patient, Dublin, Ireland
Cross References

Nucleotide (GenBank) : JQ070170 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JQ070103 ITS including 5.8S rRNA gene

References

Sullivan DJ, et al. Candida dubliniensis sp. nov.: phenotypic and molecular characterization of a novel species associated with oral candidosis in HIV-infected individuals. Microbiology 141: 1507-1521, 1995. PubMed: 7551019

Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410

Valach M, et al. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria. Nucleic Acids Res. 39: 4202-4219, 2011.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation