Candida albicans (Robin) Berkhout, anamorph (ATCC® MYA-4901)

Strain Designations: 529L  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 529L
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype Not available
Preceptrol® no
Comments Genome sequencing strain (NIH, USA)
Morphology On YM medium at 25°C after 3 days, colonies white to creamy white, smooth with some colonies becoming wrinkled with age, entire margin with some colonies becoming filamentous with age, raised. Cells subglobose to broadly ovoid, smooth, single or in short chains, 3-4.5 x 3.75-6.75 µm. Pseudohyphae present.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence; GenBank number KC113639:

AAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCTACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATAT


D1D2 region of the 26S ribosomal RNA gene; GenBank number KC113635:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCG

Morphology On YM medium at 25°C after 3 days, colonies white to creamy white, smooth with some colonies becoming wrinkled with age, entire margin with some colonies becoming filamentous with age, raised. Cells subglobose to broadly ovoid, smooth, single or in short chains, 3-4.5 x 3.75-6.75 µm. Pseudohyphae present.
Name of Depositor J. Naglik
Chain of Custody ATCC <-- J. Naglik; King's College London
Isolation Oral cavity of human, London, UK.
Cross References

Nucleotide (GenBank) : KC113639 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : KC113635 D1D2 region of the 28S ribosomal RNA gene

References

Moyes DL, et al. A biphasic innate immune MAPK response discriminates between the yeast and hyphal forms of Canida albicans in epithelial cells. Cell Host Microbe 8: 225-235, 2010.

Rahman D, et al. Murine model of concurrent oral and vaginal Candida albicans colonization to study epithelial host-pathogen interactions. Microbes Infect. 9: 615-622, 2007. PubMed: 17383212

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation