Gonapodya prolifera (ATCC® MYA-4800)

Strain Designations: JEL 478 [M# 06]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations JEL 478 [M# 06]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On mPmTG after 66 days at 25°C, colonies white to creamy white, velutinus, semi dense. Mycellium composed of broadly fusiform segments. Gametangia globose to  subglobose, some with papilate apex, smooth, 14.25-22.5 µm X 13.5-21 µm, contain globose gametes, 3-6 µm X 3-6 µm.
Medium Medium 2786: mPmTG
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ACTCTAGGTGCGCTTTACGGCCTGCCTGTGATTTCCCAACACCCGTCACACCATGTGAACTGTTTACTGTCTCTGGCAGGCGGCGCCTTTTTTTTCAAAGCTTTCATCTCTTTACGGGGGTAAGGCCCAAAAAAAAAGGTTGATAGCTGCGAAGCCCGGCCTTTGGGCCGACTTTGCGGATCTATCTTTGTCTAACCTGCCAAACCTTTATACCAACTCTTGTGTCTTAACTCTGTAATCGACTGAACCACATATTTTTTTGAATAAAACCAATTCAAAAACAACTTTTGACAACGGATCTCTTGGCTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCATATTGCGACCTTCTGGTATTCCAGGAGGTATGCCTGTTTGAGAATCGTGACTCCCCTCACTCATGCTTTGGTATGTGTGGACTTGAGCCTTTCCCGGGGTTATGTTGAGGTCGCGCTTTTTACGGCGTGCCTTTGGCAGAAAACCGGGTGGCTTGAAATATAGGTGAGCCTTGGAACCAAACATCTCAGTGGTTAAAAAGGCGTGATAAAACGCAGTCTTCCTTTTTGGGGGGGCCCGCAATTATATCTCTAGCTTTATAAACCGTTGGGAACTTTAAAAGTTTGACTCCGAGTCTAAGCTTGCACACGCAGGAACTAAAGCGTAAAAGCGTGTGGTAGTAGACCAAGGCGATTTCAAACCTCGCTTTGACTCCCTACCCCCCCGCCCCGCTT


D1D2 region of the 28S ribosomal RNA gene:

AAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAACAGCTCAAATTTGAAATCTCCGGGGTCCCCCTGGCGAATTGTAGTTTCGAGAAGTGTTTTCGGCGGCGGCCTTGGCCCAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAACCCCGTGAAGCCTTGGCTTGCTGCTATGTGATACACTTTCAAAGAGTCGGGTTGTTTGGGATTGCAGCCCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAAGGCTTGAAACCAGTCATGCTGTCTGCGATTCAGCGGGCCACGCCGGCACGTTCATTTCGCAGATGGCAGGTCAACGTCGGTTTCCTTCGCGTCGAAAGGCCTTGGGCAGGTAGCTTGCCTTTACGGGCGAGTGTTATAGCCACTTGGCTCTGGCGTGTGGGGGGACCGAGGACCGCAGGGCGCATTGGGACTTTCGGGTAGTGTGAACGCTTTTTGCAGACTGCATGCAGGCTGCAAGAAGTCGTAGGGCTTTCCCGGCAAGCTCCTCTCCGACCCTTAGGACGTTGACGAAATG

Morphology On mPmTG after 66 days at 25°C, colonies white to creamy white, velutinus, semi dense. Mycellium composed of broadly fusiform segments. Gametangia globose to  subglobose, some with papilate apex, smooth, 14.25-22.5 µm X 13.5-21 µm, contain globose gametes, 3-6 µm X 3-6 µm.
Name of Depositor M Berbee
Special Collection ATCC
Chain of Custody
ATCC <-- M Berbee <-- J Longcore <-- M Mollicone
Isolation
Cattail pond in Augusta, Maine, USA. September, 1989
Cross References

Nucleotide (GenBank) : JN874506 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JN882326 ITS including 5.8S rRNA gene

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation