Gonapodya prolifera (ATCC® MYA-4800)

Strain Designations: JEL 478 [M# 06]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations JEL 478 [M# 06]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On mPmTG after 66 days at 25°C, colonies white to creamy white, velutinus, semi dense. Mycellium composed of broadly fusiform segments. Gametangia globose to  subglobose, some with papilate apex, smooth, 14.25-22.5 µm X 13.5-21 µm, contain globose gametes, 3-6 µm X 3-6 µm.
Medium ATCC® Medium 2786: mPmTG
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ACTCTAGGTGCGCTTTACGGCCTGCCTGTGATTTCCCAACACCCGTCACACCATGTGAACTGTTTACTGTCTCTGGCAGGCGGCGCCTTTTTTTTCAAAGCTTTCATCTCTTTACGGGGGTAAGGCCCAAAAAAAAAGGTTGATAGCTGCGAAGCCCGGCCTTTGGGCCGACTTTGCGGATCTATCTTTGTCTAACCTGCCAAACCTTTATACCAACTCTTGTGTCTTAACTCTGTAATCGACTGAACCACATATTTTTTTGAATAAAACCAATTCAAAAACAACTTTTGACAACGGATCTCTTGGCTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCATATTGCGACCTTCTGGTATTCCAGGAGGTATGCCTGTTTGAGAATCGTGACTCCCCTCACTCATGCTTTGGTATGTGTGGACTTGAGCCTTTCCCGGGGTTATGTTGAGGTCGCGCTTTTTACGGCGTGCCTTTGGCAGAAAACCGGGTGGCTTGAAATATAGGTGAGCCTTGGAACCAAACATCTCAGTGGTTAAAAAGGCGTGATAAAACGCAGTCTTCCTTTTTGGGGGGGCCCGCAATTATATCTCTAGCTTTATAAACCGTTGGGAACTTTAAAAGTTTGACTCCGAGTCTAAGCTTGCACACGCAGGAACTAAAGCGTAAAAGCGTGTGGTAGTAGACCAAGGCGATTTCAAACCTCGCTTTGACTCCCTACCCCCCCGCCCCGCTT


D1D2 region of the 28S ribosomal RNA gene:

AAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAACAGCTCAAATTTGAAATCTCCGGGGTCCCCCTGGCGAATTGTAGTTTCGAGAAGTGTTTTCGGCGGCGGCCTTGGCCCAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAACCCCGTGAAGCCTTGGCTTGCTGCTATGTGATACACTTTCAAAGAGTCGGGTTGTTTGGGATTGCAGCCCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTCAAAAGGGAAAGGCTTGAAACCAGTCATGCTGTCTGCGATTCAGCGGGCCACGCCGGCACGTTCATTTCGCAGATGGCAGGTCAACGTCGGTTTCCTTCGCGTCGAAAGGCCTTGGGCAGGTAGCTTGCCTTTACGGGCGAGTGTTATAGCCACTTGGCTCTGGCGTGTGGGGGGACCGAGGACCGCAGGGCGCATTGGGACTTTCGGGTAGTGTGAACGCTTTTTGCAGACTGCATGCAGGCTGCAAGAAGTCGTAGGGCTTTCCCGGCAAGCTCCTCTCCGACCCTTAGGACGTTGACGAAATG

Morphology On mPmTG after 66 days at 25°C, colonies white to creamy white, velutinus, semi dense. Mycellium composed of broadly fusiform segments. Gametangia globose to  subglobose, some with papilate apex, smooth, 14.25-22.5 µm X 13.5-21 µm, contain globose gametes, 3-6 µm X 3-6 µm.
Name of Depositor M Berbee
Special Collection ATCC
Chain of Custody
ATCC <-- M Berbee <-- J Longcore <-- M Mollicone
Isolation
Cattail pond in Augusta, Maine, USA. September, 1989
Cross References

Nucleotide (GenBank) : JN874506 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JN882326 ITS including 5.8S rRNA gene

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation