Candida albicans (Robin) Berkhout, anamorph (ATCC® MYA-4779)

Strain Designations: CHN1  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CHN1
Application
Opportunistic pathogen research
Sexually Transmitted Disease Research
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
clinical isolate
genome sequencing strain (Broad Institute, USA)
Morphology After 5 days at 25°C on YM medium, colonies white to creamy white, dull, smooth, raised, margin filamentous. On YEPD medium, colonies similar but wrinkled. Cells globose to subglobose, smooth, large cells 9-13.5 µm x 6-9 µm, small cells 3.75-6 µm x 3-4.5 µm. Pseudohyphae abundant on both YM and YEPD media.
Medium Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions Temperature: 30°C to 37°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCTACCACGTATATCTTCAAACTTTGACCTCAAATCA


D1D2 region of the 28S ribosomal RNA gene:

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATGCTGCCAGCCTAGACCGAGGACTGCGGTTTTTAACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTGA

Morphology After 5 days at 25°C on YM medium, colonies white to creamy white, dull, smooth, raised, margin filamentous. On YEPD medium, colonies similar but wrinkled. Cells globose to subglobose, smooth, large cells 9-13.5 µm x 6-9 µm, small cells 3.75-6 µm x 3-4.5 µm. Pseudohyphae abundant on both YM and YEPD media.
Name of Depositor M Noverr
Special Collection ATCC
Chain of Custody
ATCC <-- M Noverr <-- G Huffnagle
Cross References

Nucleotide (GenBank) : JN874492 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JN882313 ITS including 5.8S rRNA gene

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation