Fusarium oxysporum f. sp. lycopersici (Saccardo) Snyder et Hansen, anamorph (ATCC® MYA-4623)

Strain Designations: FGSC 9935 [NRRL 34936, 4287]  /  Product Format: frozen

Strain Designations FGSC 9935 [NRRL 34936, 4287]
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA).
Plant pathogen.
Medium Medium 336: Potato dextrose agar (PDA)
Medium 324: Malt extract agar
Growth Conditions
Temperature: 25.0°C
Sequenced Data
>ITS of MYA-4623

GTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA

//

Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Cross References

Nucleotide (GenBank) : GU327639 ITS including 5.8S rRNA gene

References

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Ma LJ, et al. Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 464: 367-373, 2010. PubMed: 20237561