Dekkera bruxellensis van der Walt, teleomorph (ATCC® MYA-4596)

Alternate State: Brettanomyces bruxellensis Kufferath et van Laer, anamorph  /  Strain Designations: Y879 [CBS 2499]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations Y879 [CBS 2499]
Alternate State Brettanomyces bruxellensis Kufferath et van Laer, anamorph
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Wine spoilage yeast.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Sequenced mitochondrial genome.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 DNA sequence of MYA-4596

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAATGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCGGGCAACCGAGTTGTAATTTGGAGACGGGACACTAGAGAGGAGGAAGGCGATTAAGTGCCTTGGAACAGGCTGCCGTAGAGGGTGAGAGCCCCGTGAATCGCTGGAGACCGATCAATTAGTGCCCGCCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATTAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGAGTGAAATAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGCGGCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGTTCTGGGAGCCATATACGGGGTTCGTGAATGTGGCCCTTCGATTCTGTCGGAGGGTGTTATAGCGCGGACATCTTGTGGCTAGCCGGGACCGGGGACTGCGGTGACTTGTCACCAAGGATGCTGGCAGAACGAGCAAATACCACCCGTCTTG

Name of Depositor J Piskur
Special Collection ATCC
Chain of Custody
ATCC <-- J Piskur <-- CBS
Isolation
Wine, Medoc, France.
Cross References

Nucleotide (GenBank) : GU291284 D1/D2 region of 28S rRNA gene

References

Woolfit M, et al. Genome survey sequencing of the wine spoilage yeast Dekkera (Brettanomyces) bruxellensis. Eukaryot. Cell 6:721-733, 2007.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation