Rhizoctonia solani Kuhn, anamorph (ATCC® MYA-4579)

Alternate State: Thanatephorus cucumeris (Frank) Donk, teleomorph  /  Strain Designations: Rhs 1AP  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Rhizoctonia solani Kuhn anastomosis group 3 (AG-3)
Strain Designations Rhs 1AP
Alternate State Thanatephorus cucumeris (Frank) Donk, teleomorph
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Plant pathogen.
Anastomosis group 3 (AG-3).
Genome sequencing strain (J. Craig Venter Institute and North Carolina State University, USA).
Sequenced Data
ITS DNA sequence of MYA-4579 lot 58641356

CCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTTTAATGAAGAGTTTGGTTGTAGCTGGTCTATTTATTTAGGCATGTGCACACCTCCCTCTTTCATCCCACACACACCTGTGAACTTGTGAGACAGTTGGGGAATTTATTTGTTATTTTTTGTAATAAAATGATAATAAGTCATTGAACCCTTCTGTCTACTCAACTCATATAAAATCAATTTATTTTAAATGAATGTAATGGATGTAACACATCTCATACTAAGTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCTTGGAGCATGCCTGTTTGAGTATCATGAAATCTTCAAAATCAATCTTTTTGTTAACTCAATTAGTTTGATTTTGGTATTGGAGGTCTTTTGCAGCTTCACACCTGCTCCTCTTTGTGTATTAGCTGGATCTCAGTGTTATGCTTGGTTCCACTCAGCGTGATAAATTATCTATCGCTGAGGACACTGTAAAAAGTGGCCAAGGTAAATGCAGATGAACCGCTTCTAATAGTCCATTGACTTGGACACTATTATTATGATCTGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC

Name of Depositor MA Cubeta
Special Collection ATCC
Chain of Custody
ATCC <-- MA Cubeta <-- SM Tavantzis
Isolation
Potato stem, Maine, USA.
Cross References

Nucleotide (GenBank) : GU291259 ITS including 5.8S rRNA gene

References

Jian J, Lakshman DK, Tavantzis SM. Association of Distinct Double-Stranded RNAs with Enhanced or Diminished Virulence in Rhizoctonia solani Infecting Potato. Mol. Plant-Microbe Interact. 10: 1002-1009, 1997.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation