Rhizoctonia solani Kuhn, anamorph (ATCC® MYA-4579)

Alternate State: Thanatephorus cucumeris (Frank) Donk, teleomorph  /  Strain Designations: Rhs 1AP  /  Product Format: frozen

Deposited As Rhizoctonia solani Kuhn anastomosis group 3 (AG-3)
Strain Designations Rhs 1AP
Alternate State Thanatephorus cucumeris (Frank) Donk, teleomorph
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Plant pathogen.
Anastomosis group 3 (AG-3).
Genome sequencing strain (J. Craig Venter Institute and North Carolina State University, USA).
Sequenced Data
ITS DNA sequence of MYA-4579 lot 58641356

CCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTTTAATGAAGAGTTTGGTTGTAGCTGGTCTATTTATTTAGGCATGTGCACACCTCCCTCTTTCATCCCACACACACCTGTGAACTTGTGAGACAGTTGGGGAATTTATTTGTTATTTTTTGTAATAAAATGATAATAAGTCATTGAACCCTTCTGTCTACTCAACTCATATAAAATCAATTTATTTTAAATGAATGTAATGGATGTAACACATCTCATACTAAGTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCTTGGAGCATGCCTGTTTGAGTATCATGAAATCTTCAAAATCAATCTTTTTGTTAACTCAATTAGTTTGATTTTGGTATTGGAGGTCTTTTGCAGCTTCACACCTGCTCCTCTTTGTGTATTAGCTGGATCTCAGTGTTATGCTTGGTTCCACTCAGCGTGATAAATTATCTATCGCTGAGGACACTGTAAAAAGTGGCCAAGGTAAATGCAGATGAACCGCTTCTAATAGTCCATTGACTTGGACACTATTATTATGATCTGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC

Name of Depositor MA Cubeta
Special Collection ATCC
Chain of Custody
ATCC <-- MA Cubeta <-- SM Tavantzis
Isolation
Potato stem, Maine, USA.
Cross References

Nucleotide (GenBank) : GU291259 ITS including 5.8S rRNA gene

References

Jian J, Lakshman DK, Tavantzis SM. Association of Distinct Double-Stranded RNAs with Enhanced or Diminished Virulence in Rhizoctonia solani Infecting Potato. Mol. Plant-Microbe Interact. 10: 1002-1009, 1997.