Aspergillus brasiliensis Varga et al. (ATCC® MYA-4553)

Strain Designations: CBS 101740 [IBT 21946, IMI 381727]  /  Product Format: frozen

Strain Designations CBS 101740 [IBT 21946, IMI 381727]
Biosafety Level 1
Product Format frozen
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
A black aspergillus in Aspergillus section Nigri.
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 25.0°C
Sequenced Data
>ITS DNA sequence for MYA-4553

ATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACCCTGTCTGAAAGCGTGCAGTCTGAGTCGATTGTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCTCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS
Isolation
Soil, Pedreira, Sao Paulo, Brazil.
Cross References

Nucleotide (GenBank) : FJ810517 ITS including 5.8S rRNA gene

References

Varga J, et al. Aspergillus brasiliensis sp. nov., a biseriate black Aspergillus species with world-wide distribution. Int. J. Syst. Evol. Microbiol. 57: 1925-1932, 2007.