Saccharomyces kudriavzevii Naumov et al. (ATCC® MYA-4449)

Strain Designations: CBS 8840 (IFO 1802; NCYC 2889; MUCL 46198)  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CBS 8840 (IFO 1802; NCYC 2889; MUCL 46198)
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Washington University School of Medicine, USA).
Morphology On YM medium at 25°C after 2 days, colonies creamy white to dingy white, smooth, slightly raised, margin entire. Cells globose to subglobose, smooth, guttulate, 5.0-9.0 X 4.0-7.5 µm. Pseudohyphae not observed.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
ITS sequence

AAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTGTTTGTTTTGGCAAGAGCGTGAGAGCTTTTACTGGGCAAGTAGACAAGAGATGGAGAGTCCGGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGCAAGTTTCTTTCTTGCTATTCCAAACAGTGAGAGATTTCTCTGTTTTCGTTATAGGACAATCAAAACCGTTTCAATACAACACACTGTGGAGTTTTTATATCTTTGCAACTTTTTCTTTGGGCTGTCGAGCAATCGGAGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTGTACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATATTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAA


D1D2 sequence

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGAACCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCGTAGGAATGTAACTTGCTTCGGGAAGTATTATAGCCTGCGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCG

Morphology On YM medium at 25°C after 2 days, colonies creamy white to dingy white, smooth, slightly raised, margin entire. Cells globose to subglobose, smooth, guttulate, 5.0-9.0 X 4.0-7.5 µm. Pseudohyphae not observed.
Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS
Isolation
Decayed leaf, Japan
Cross References

Nucleotide (GenBank) : KC881094 RNA polymerase II largest subunit (RPB1) gene

Nucleotide (GenBank) : KC881091 polymerase II second largest subunit (RPB2) gene

Nucleotide (GenBank) : KC881099 translation elongation factor 1-alpha gene

Nucleotide (GenBank) : FJ196731 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ196779 ITS including 5.8S rRNA gene

References

Naumov GI, et al. Three new species in the Saccharomyces sensu stricto complex: Saccharomyces cariocanus, Saccharomyces kudriavzevii and Saccharomyces mikatae. Int. J. Syst. Evol. Microbiol. 50: 1931-1942, 2000. PubMed: 11034507

Cliften P, et al. Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 30: 71-76, 2003. PubMed: 2775844

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Suh SO, et al. Update of USP drug testing reference strain ATCC® 2601™. Pharma. Microbiol. Forum Newslett. 19: 4-11, 2013.

Hittinger CT, et al. Remarkably ancient balanced polymorphisms in a multi-locus gene network. Nature 464: 54-58, 2010. PubMed: 20164837

Huang CH, Lee FL, Tai CJ. The beta-tubulin gene as a molecular phylogenetic marker for classification and discrimination of the Saccharomyces sensu stricto complex. Antonie van Leeuwenhoek 95: 135-142, 2009. PubMed: 19112604

Dandjinou AT, et al. A phylogenetically based secondary structure for the yeast telomerase RNA. Curr Biol 14: 1148-1158, 2004. PubMed: 15242611

Hittinger CT, Rokas A, Carroll SB. Parallel inactivation of multiple GAL pathway genes and ecological diversification in yeasts. Proc Natl Acad Sci USA 101: 14144-14149, 2004. PubMed: 15381776

Lin J, et al. A universal telomerase RNA core structure includes structured motifs required for binding the telomerase reverse transcriptase protein. Proc Natl Acad Sci USA 101: 14713-14718, 2004. PubMed: 15371596

Fischer G, et al. Chromosomal evolution in Saccharomyces. Nature 405: 451-454, 2000. PubMed: 10839539

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation