Candida alai Suh et al. (ATCC® MYA-4364)

Strain Designations: BG 03-6-5-1-2 [CBS 9899, NRRL Y-27739]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations BG 03-6-5-1-2 [CBS 9899, NRRL Y-27739]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments
Insect associated yeast.
mitochondrial genome sequenced strain
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTACTGTGCTTAATTGCACGGATATCTACACACGTGTTTTCTTGGAAAACTTGCTTTCGTCTAAAGTCAGGCGAGAGAAAAACTAACGAAAAATTATTATTTATTTGTCAATACCAACTAAATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTTGTGAGTGATACTCCCAGACTGGGCGTTTGCTTGAAAAGTAATGGCGGGGATGCGTCAGCGTATAACGACAATGTATTAGGTTCTACCAACTCATTGTGTGTTTTGCTGTGTGCGCGGCCCGCGGTACCAAATCAACAAACCAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTACGGCACTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGTTGTCCGTGTCCGTGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTTGGTATTTTGCATGGCTCTCGGGTCCTCTGCAGTTTACTGGGCCAGCATCGGTTTGTCTGGCGGGATAATTGCGCAGGAATGTGGCACGGTTCGCCGTGTGTTATAGCCTGTGTGGATGCCGGCGGGTAGACCGAGGACTGCGATTTTTTTAATCTAGGATG CTGGCATAATGATCCCAAACCGC

Name of Depositor SO Suh
Special Collection ATCC
Chain of Custody
ATCC <-- SO Suh
Isolation
Gut of Alaus myops (Elateridae), Livingston Parish, LA, USA
Cross References

Nucleotide (GenBank) : FJ614698 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ623626 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC507446 EF-1 alpha gene

Nucleotide (GenBank) : KC507415 RPB1 gene

References

Suh SO, et al. Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov., and Candida manassasensis sp. nov., four novel yeasts associated with wood- ingesting insects and their ecological and biofuel implications. Int. J. Syst. Evol. Microbiol. 63: 4330-4339, 2013. PubMed: 24014624

Suh SO, Nguyen NH, Blackwell M. Yeasts isolated from plant-associated beetles and other insects: seven novel Candida species near Candida albicans. FEMS Yeast Res. 8: 88-102, 2008.

Valach M, et al. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria. Nucleic Acids Res. 39: 4202-4219, 2011.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation