Blastomyces dermatitidis Gilchrist et Stokes (ATCC® MYA-2586)

Alternate State: Ajellomyces dermatitidis McDonough et Lewis, teleomorph  /  Strain Designations: ER-3  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Blastomyces dermatitidis Gilchrist et Stokes, anamorph
Strain Designations ER-3
Alternate State Ajellomyces dermatitidis McDonough et Lewis, teleomorph
Application
Emerging infectious disease research
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA).
Morphology After 11 days on Emmons’ at 37°C, colonies are sparse, thin, cream-colored. Cells globose, single or in pairs, pseudohyphae with blastoconidia present.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 37°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGATCATTAACGCGCCGTGGGGGGTTGGACCTCCTAGACCGGAGGAACCCCGGCCCCCTCACCTGGCCACCCTTGTCTATTTTTACCTGTTGCTTCGGCGGGCCTGCAGCGATGCTGCCGGGGGAGTTTTCACTCCCCGGGCTCGTGCCCGCCGAGGACACCGCTAGAACTTCTGGTGAACGATTGACATCTGAGAAAATAACTATAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCAACCCTCAAGCGCGGCTTGTGTGTTGGGCCTTCGTCCCCCCGTGGACGTGCCCGAAATGCAGCGGCGGCGTCGTGTTCCGGTGCCCGAGCGTATGGGGCTTTGTCACCCGCTCTAGAGGCCCGGCCGGCTCCGGCCCCATCTCAAACCCTTCGAGGGAGGGCGGTCTTCGGGCCGGTCTCCCCACCAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCCTTTGGGGCCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGTGGCCGCGGTCTAAGTCCCCTGGAACGGGGCGTCGCAGAGGGTGAGAATCCCGTCTTCGGCCGGCCGGCTTCGCCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGTCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCATGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGAGTCGGCCGTGGGGGTTCAGCGGGCATTCGTTGCCCGTGCACTCCCCCACGGGCGGGCCAGCGTCGGTTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGCCTCTCGGGGCGTCTTATAGCCGGGGGTGCAATGCGGCCAGTCGGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCTTAATGGTCGTAAGCGAC

Morphology After 11 days on Emmons’ at 37°C, colonies are sparse, thin, cream-colored. Cells globose, single or in pairs, pseudohyphae with blastoconidia present.
Name of Depositor DJ Baumgardner
Special Collection NCRR Contract
Isolation
Soil under a woodpile, Eagle River, Wisconsin, United States, November 10, 1997
Year of Origin 1997
Cross References

Complete Genome (GenBank) : ACBT00000000 Ajellomyces dermatitidis ER-3, whole genome shotgun sequencing project

References

Baumgardner DJ, Paretsky DP. The in vitro isolation of Blastomyces dermatitidis from a woodpile in north central Wisconsin, USA. Med. Mycol. 37: 163-168, 1999. PubMed: 10421847

Baumgardner DJ, Laundre B. Studies on the molecular ecology of Blastomyces dermatitidis. Mycopathologia 152: 51-58, 2001.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation