Cryptococcus amylolentus (van der Walt et al.) Golubev, anamorph (ATCC® 56469)

Strain Designations: NRRL Y-7784 [CBS 6039, IFO 10423, JCM 1690]  /  Product Format: freeze-dried

Strain Designations NRRL Y-7784 [CBS 6039, IFO 10423, JCM 1690]
Application
Multigene phylogeny and phenotypic characterization.
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments
utilizes D-xylose, xylitol and D-xylonate
Multigene phylogeny and phenotypic characterization.
Genome sequencing strain (Broad Institute, USA)
Morphology After 3 days on YM at 25°C, two colony types present on plates. One type off-white, smooth, mucoid, glistening; yeast cells subglobose or ovoid, single or in pairs, no pseudohyphae present. Second type white, raised, rough, dull; yeast cells subglobose or ovoid, single or in pairs, pseudohyphae present.
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 324: Malt extract agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCAGTAGAGAATAACGGACTTCGGTCCATATATCTACCCATCTACACCTGTGAACCGTATTTGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAAACTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAACATCTCAATCCTTCGGGTTTATGACCTGTTGGCATTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGACGTAATAAGTTTCGTTGGGCCTATGGGGTAGTTGTCGGCTTGCTTATAACAACCATCTTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTTCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACTGTGTCTAAGTTCCTTGGAATAGGATATCAAAGAGGGTGACAATCCCGTACTTGACACAATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTGCTTGGGAATGCAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAACCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCACGAGGAATGTAGCAATCTTCGGGTTGTGTTATAGCCTTGTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGAC

Morphology After 3 days on YM at 25°C, two colony types present on plates. One type off-white, smooth, mucoid, glistening; yeast cells subglobose or ovoid, single or in pairs, no pseudohyphae present. Second type white, raised, rough, dull; yeast cells subglobose or ovoid, single or in pairs, pseudohyphae present.
Name of Depositor NRRL
Isolation Frass of the tunnels of Sinoxylon ruficorne infesting Dichrostachys cinerea near Groblersdal, Transvaal, South Africa
Cross References

Nucleotide (GenBank) : AF105391 26S ribosomal RNA gene, partial sequence

References

van der Walt JP, et al. Six new Candida species from South African insect sources. Mycopathol. Mycol. Appl. 47: 221-236, 1972.

van der Walt JP, Steyn RL. Note on D-xylonate utilization by ascomycetous and basidiomycetous yeasts. Syst. Appl. Microbiol. 13: 192-193, 1990.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Findley K, et al. Phylogeny and phenotypic characterization of pathogenic Cryptococcus species and closely related saprobic taxa in the Tremellales. Eukaryot. Cell 8: 353-361, 2009.