Rhodosporidium toruloides Banno (ATCC® 204091)

Strain Designations: IIP 30 [MTCC 1151]  /  Product Format: frozen

Deposited As Rhodotorula glutinis (Fresenius) Harrison, anamorph
Strain Designations IIP 30 [MTCC 1151]
Application
produces lipids
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (Mississippi State University, USA)

The sequences of D1/D2 region and ITS from this strain are highly similar (99-100%) to those of ATCC 10657, type strain of Rhodosporidium toruloides.
Medium ATCC® Medium 1245: YEPD
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATATTAGGGTGTCCAACTTAACTTGGAGCCCGACCCTCACTTTCTAACCCTGTGCATTTGTCTTGGGTAGTAGCTCGCGTCAGCGAGCGAATCCCATTTCACTTACAAACACAAAGTCTATGAATGTAACAAATTTATAACAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAATTCTTCAACCCACCTCTTTCTTAGTGAATCAGGCGGTGTTTGGATTCTGAGCGTTGCTGGCTTCGCGGCCTAGCTCGCTCGTAATGCATTAGCATCCGCAATCGAACTTCGGATTGACTCGGCGTAATAGACTATTCGCTGAGGATTCTGGTCTCTGACTGGAGCCGGGTAAGATTAAAGGAAGCTACCAATCCTCATGTCTATCTTTTGAGATTAGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAGTGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGATACCCCATTACACGGTGCGGACGCCCAGCGCTTTGTGATACACTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGGGCTTGCTCGGTTTGCAGGCCAGCATCAGTTTTCTGGGACGGATAATGGCAGTTAGAATGTAGCAGTCTCGGCTGTGTTATAGCTTTCTGCTGGATACGTCCTGGGGGACTGAGGAACGCAGCGTGCCGTATGGCGAGGGCTTTGGTCCTTTCACGCTTAGGATGCTGGTGGAATGGCTTTAAACGAC

Name of Depositor NK Yadav
Chain of Custody
ATCC <-- NK Yadav <-- VW Johnson
Isolation
Soil, Baroda, India
References

Pathak R, Yadav NK. Influence of cultural conditions on lipid production by mutant strain of Rhodotorula glutinis MTCC 1151. Indian J. Exp. Biol. 35: 366-368, 1997. PubMed: 9315236

N K Yadav, personal communication

Yu X, et al. Oil production by oleaginous yeasts using the hydrolysate from pretreatment of wheat straw with dilute sulfuric acid. Bioresour. Technol. 102: 6134-6140, 2011. PubMed: 21463940