Aspergillus niger van Tieghem, anamorph (ATCC® 1015)

Strain Designations: A1144 3528.7 [ATCC 10582, CBS 113.46, IMI 31821, LSHB Ac4, NCTC 3858a, NRRL 1278, NRRL 328, NRRL 350, NRRL 511, TC 167]  /  Product Format: freeze-dried

Strain Designations A1144 3528.7 [ATCC 10582, CBS 113.46, IMI 31821, LSHB Ac4, NCTC 3858a, NRRL 1278, NRRL 328, NRRL 350, NRRL 511, TC 167]
Application
Degrades apple pomace
Produces citric acid citrate
Produces glucoamylase
Produces citric acid from apple pomace
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Intended Use
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Antigens
Parent of ATCC 11414
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 323: Malt agar medium
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGAGTCCGCATTGTAATTTGCAGAGGATGCTTTGGGTGCGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGGTGTCCGTGCCCGTGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCCTGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCAGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC

Name of Depositor C Thom
Chain of Custody
ATCC <-- C Thom <-- Mellon Inst.
Cross References

Nucleotide (GenBank) : JX535496 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX535499 D1/D2 region of 28S region

Nucleotide (GenBank) : X52521 Aspergillus niger bphA gene for benzoate-para-hydroxylase

Nucleotide (GenBank) : ACJE01000000 Aspergillus niger ATCC 1015, whole genome shotgun sequencing project

References

van Verseveld HW, et al. Determination of the maximum product yield from glucoamylase-producing Aspergillus niger grown in the recycling fermentor. Antonie van Leeuwenhoek 60: 313-323, 1991. PubMed: 1807200

Kim SJ, Chaparas SD. Characterization of antigens from Aspergillus fumigatus. III. Comparison of antigenic relationships of clinically important aspergilli. Am. Rev. Respir. Dis. 120: 1297-1303, 1979. PubMed: 92906

Metwally M. Glucoamylase production in continuous cultures of Aspergillus niger with special emphasis on growth parameters. World J. Microbiol. Biotechnol. 14: 113-118, 1998.

Hang YD, Woodams EE. Apple pomace: a potential substrate for citric acid production by Aspergillus niger. Biotechnol. Lett. 6: 763-764, 1984.

Currie JN. The citric acid fermentation of Aspergillus niger. J. Biol. Chem. 31: 15-37, 1917.

Andersen MR, et al. Comparative genomics of citric-acid-producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88. Genome Res. 21: 885-897, 2011. PubMed: 21543515