Aspergillus sojae Sakaguchi et Yamada, anamorph (ATCC® MYA-4878)

Strain Designations: CBS 100932 [NBRC 4239, IFO 4239, IAM 2665]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CBS 100932 [NBRC 4239, IFO 4239, IAM 2665]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Kikkoman Corp., Japan)
Morphology On PDA medium at 25°C after 2 days, mycelium white, cottony, becoming dark green as conidia develop. Hyphae guttulate. Conidiophores uniserate. Phialides lecythiform, 9-13µm X 4-5µm. Conidia pale green to army green in mass, globose to subglobose, tuberculateechinulate, 6-9µm X 6-7.5µm.
Medium ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGCGTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAAACAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

 

D1D2 region of the 28S ribosomal RNA gene:

ATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGACCCGTCTTG

Morphology On PDA medium at 25°C after 2 days, mycelium white, cottony, becoming dark green as conidia develop. Hyphae guttulate. Conidiophores uniserate. Phialides lecythiform, 9-13µm X 4-5µm. Conidia pale green to army green in mass, globose to subglobose, tuberculateechinulate, 6-9µm X 6-7.5µm.
Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- K Abe
Isolation
Soy sauce, Japan.
Cross References

Complete Genome (GenBank) : BACA00000000 Aspergillus sojae NBRC 4239, whole genome shotgun sequencing project

Nucleotide (GenBank) : JQ812709 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ812703 D1/D2 region of LSU rRNA gene

References

Sato A, et al. Draft genome sequencing and comparative analysis of Aspergillus sojae NBRC4239. DNA Res. 18: 165-176, 2011. PubMed: 21659486

Gustafson G and Armour SL. The complete nucleotide sequence of RNA beta from the type strain of barley stripe mossaic virus. Nucleic Acids Res. 14(9):3895-3909, 1986. PubMed: 3754962

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation