Aspergillus sojae Sakaguchi et Yamada, anamorph (ATCC® MYA-4878)

Strain Designations: CBS 100932 [NBRC 4239, IFO 4239, IAM 2665]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CBS 100932 [NBRC 4239, IFO 4239, IAM 2665]
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Kikkoman Corp., Japan)
Morphology On PDA medium at 25°C after 2 days, mycelium white, cottony, becoming dark green as conidia develop. Hyphae guttulate. Conidiophores uniserate. Phialides lecythiform, 9-13µm X 4-5µm. Conidia pale green to army green in mass, globose to subglobose, tuberculateechinulate, 6-9µm X 6-7.5µm.
Medium Medium 324: Malt extract agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGCGTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAAACAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA

 

D1D2 region of the 28S ribosomal RNA gene:

ATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGACCCGTCTTG

Morphology On PDA medium at 25°C after 2 days, mycelium white, cottony, becoming dark green as conidia develop. Hyphae guttulate. Conidiophores uniserate. Phialides lecythiform, 9-13µm X 4-5µm. Conidia pale green to army green in mass, globose to subglobose, tuberculateechinulate, 6-9µm X 6-7.5µm.
Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- K Abe
Isolation
Soy sauce, Japan.
Cross References

Complete Genome (GenBank) : BACA00000000 Aspergillus sojae NBRC 4239, whole genome shotgun sequencing project

Nucleotide (GenBank) : JQ812709 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ812703 D1/D2 region of LSU rRNA gene

References

Sato A, et al. Draft genome sequencing and comparative analysis of Aspergillus sojae NBRC4239. DNA Res. 18: 165-176, 2011. PubMed: 21659486

Gustafson G and Armour SL. The complete nucleotide sequence of RNA beta from the type strain of barley stripe mossaic virus. Nucleic Acids Res. 14(9):3895-3909, 1986. PubMed: 3754962

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation