Aspergillus terreus Thom, anamorph (ATCC® MYA-4898)

Strain Designations: IFO 7078  /  Product Format: frozen

Strain Designations IFO 7078
Application
Produces lovastatin
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Morphology On PDA medium at 25°C after 12 days, mycelium white to pale yellow, dense, in tufts. Conidia tan to light brown with a powdery texture. Turns media bright yellow. Reverse reddish brown. Conidial heads clavate to pyriform, vesicles 10.5-15 X 9-13.5 µm. Conidia reddish brown in mass, globose to subglobose,3.75-4.5 X 3-4.5 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174057:

AAGGATCATTACCGAGTGCGGGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTTTGCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGACGCATTTATTTGCAACTTGTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174046:

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTATGGGGCGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCGGGGTTCAGCCGGGCTTCGGCCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGCGCCCTTCGGGGCGCCTTATAGCCGGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTTGTAAACGA
Morphology On PDA medium at 25°C after 12 days, mycelium white to pale yellow, dense, in tufts. Conidia tan to light brown with a powdery texture. Turns media bright yellow. Reverse reddish brown. Conidial heads clavate to pyriform, vesicles 10.5-15 X 9-13.5 µm. Conidia reddish brown in mass, globose to subglobose,3.75-4.5 X 3-4.5 µm.
Name of Depositor G Szakacs
Special Collection ATCC
Chain of Custody
ATCC <-- G Szakacs
Cross References

Nucleotide (GenBank) : JX174057 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174046 D1/D2 region of 28S rRNA gene

References

Szakacs G, et al. Production of lovastatin by a wild strain of Aspergillus terrus. Biotechnol. Lett. 20(4): 411-415, 1998.