Aspergillus terreus Thom, anamorph (ATCC® MYA-4897)

Strain Designations: TUB F-514  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations TUB F-514
Application
Produces lovastatin (mevinolin)
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Morphology On PDA medium at 25°C after 12 days, Mycelium white to pale yellow, dense, in tufts. Conidia tan to light brown with a powdery texture. Turns media bright yellow. Reverse reddish brown. Conidial heads clavate to pyriform, vesicles 10.25-25 X 15-21 µm. Conidia reddish brown in mass, globose to subglobose, 2.25-3 X 2.25-3 µm.
Medium Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Medium 324: Malt extract agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174056:

AAGGATCATTACCGAGTGCGGGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTTGCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGACGCATTTATTTGCAACTTGTTTTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174045:

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTATGGGGCGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCGGGGTTCAGCCGGGCTTCGGCCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGCGCCCTTCGGGGCGCCTTATAGCCGGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTTGTAAACGA
Morphology On PDA medium at 25°C after 12 days, Mycelium white to pale yellow, dense, in tufts. Conidia tan to light brown with a powdery texture. Turns media bright yellow. Reverse reddish brown. Conidial heads clavate to pyriform, vesicles 10.25-25 X 15-21 µm. Conidia reddish brown in mass, globose to subglobose, 2.25-3 X 2.25-3 µm.
Name of Depositor G Szakacs
Special Collection ATCC
Chain of Custody
ATCC <-- G Szakacs
Isolation
Soil, Bagdad, Iraq
Geographical Isolation Bagdad, Iraq
Cross References

Nucleotide (GenBank) : JX174056 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174045 D1/D2 region of 28S rRNA gene

References

Szakacs G, et al. Production of lovastatin by a wild strain of Aspergillus terrus. Biotechnol. Lett. 20(4): 411-415, 1998.

Morovjan G, et al. Monitoring of selected metabolites and biotransformation products from fermentation broths by high-performance liquid chromatography. J. Chromatogr. A. 763: 165-172, 1997.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation