Diplodia agrifolia (ATCC® MYA-4895)

Strain Designations: UCROK732  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Classification Pezizomycotina, Dothideomycetes, Incertae sedia, Botryosphaeriales, Botryosphaeriaceae, Diplodia, agrifolia
Strain Designations UCROK732
Biosafety Level 1
Product Format frozen
Type Strain yes
Comments
Plant pathogen
Morphology On YM medium at 25°C after 7 days, mycelium gray to olive green, tomentose. Reverse black to olive. Similar on malt extract medium but less dense. Hyphae both hyaline and smooth and dematiaceous and encrusted, guttulate.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174054:

AGGATCATTACCGAGTTCTCGGGCTTCGGCCCGAATCTCCCACCCTTTGTGAACATACCTCTGTTGCTTTGGCGGCTCTTGCCGCGTGGAGGCCCTCAAAAGCCCCCCCGCGCGCGCTTCCGCCAGAGGACCATCAAACTCCAGTCAGTGAACGTCGACGTCTGAAAAAACAAGTTAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTATTGGGCGCCGTCCTCTCTGCGGACGCGCCTCAAAGACCTCGGCGGCGGCTGTTCAGCCCTCAAGCGTAGTAGAATACACCTCGCTTTGGAGCGGTTGGCGTCGCCCGCCGGACGAACCTTCTGAACTTTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA

D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174043:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCCTTTTAGGGTCCGCGTTGTAATTTGTAGAGGATGATTCGGCGAGGGCTCCCGCCTAAGTCCCCTGGAACGGGGCGTCATAGAGGGTGAGAATCCCGTATGCGGTGGGCTGCCTTAGCCATGTGAATCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGTCCGCAGTTGCTCAGCCGGTCTCCTGACCGGCGTACTCTTCTGCGGCCAGGCCAGCATCAGTTCGGGCGGTCGGATAAAGACCTCGGGAATGTAGCTCCTCTCGGGGAGTGTTATAGCCCGGGGTGGAATGCGGCCAGCCTGGACTGAGGATCTCGCTTCGGCAAGGATGCTGGCGTAATGGTTGTAAGCGG

Morphology On YM medium at 25°C after 7 days, mycelium gray to olive green, tomentose. Reverse black to olive. Similar on malt extract medium but less dense. Hyphae both hyaline and smooth and dematiaceous and encrusted, guttulate.
Name of Depositor A Eskalen
Special Collection ATCC
Chain of Custody
ATCC <-- A Eskalen
Isolation
Coast live oak (Quercus agrifolia), Mataguay Scout Camp, San Diego County, California, USA.
Cross References

Nucleotide (GenBank) : JX174054 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174043 D1/D2 region of 28S rRNA gene

References

Lynch SC, et al. Identification and Pathogenicity of Botryosphaeriaceae species associated with coast live oak (Quercus agrifolia) decline in southern California. Mycologica 105(1):125-140, 2013. PubMed: 23074176

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation