Trichoderma virens (Miller et al.) von Arx, anamorph (ATCC® MYA-4894)

Alternate State: Hypocrea virens Chaverri et al., teleomorph  /  Strain Designations: FGSC 10586 [Tv29-8, Gv29-8]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations FGSC 10586 [Tv29-8, Gv29-8]
Alternate State Hypocrea virens Chaverri et al., teleomorph
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
mycoparasite
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On PDA medium at 25°C after 9 days, colonies dark green covered in a dense layer of white cottony mycelium. Reverse tan to yellow brown. Hyphae hyaline, guttulate. Conidiophores branched.  Phialides in whorls of 3-4, ovoid, 10.5-12 X 4.5 µm. Conidia dark green in mass, pale green singly, globose to subglobose, 3-4.5 X 3-4.5 µm.
Medium Medium 200: YM agar or YM broth
Medium 324: Malt extract agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174053:

AGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTATTGTATACCCCCTCGCGGGTTTTTTACTATCTGAGCCATCTCGGCGCCCCTCGTGGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTACGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174042:

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTCGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCGCGTCTAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGA

Morphology On PDA medium at 25°C after 9 days, colonies dark green covered in a dense layer of white cottony mycelium. Reverse tan to yellow brown. Hyphae hyaline, guttulate. Conidiophores branched.  Phialides in whorls of 3-4, ovoid, 10.5-12 X 4.5 µm. Conidia dark green in mass, pale green singly, globose to subglobose, 3-4.5 X 3-4.5 µm.
Name of Depositor FGSC
Special Collection ATCC
Chain of Custody
ATCC <-- FGSC
Cross References

Nucleotide (GenBank) : JX174053 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174042 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : ABDF00000000 Trichoderma virens Gv29-8, whole genome shotgun sequencing project

References

Kubicek CP, et al. Comparative genome sequence analysis underscores mycoparasitism as the ancestral life style of Trichoderma. Genome Biol. 12: R40, 2011. PubMed: 21501500

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation