Isaria fumosorosea Wize (ATCC® MYA-4887)

Strain Designations: ARSEF 2679  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Strain Designations ARSEF 2679
Biosafety Level 1
Product Format frozen
Type Strain no
Genome Sequenced Strain

Yes

Comments
Insect pathogenic fungi
Genome sequencing strain (Shanghai Institutes for Biological Sciences, CAC, China)
Morphology On YM medium at 25°C after 13 days, mycelium white to dingy white, dense, slightly raised forming a mound, velvety. Conidia ellipsoidal to broadly fusiform, smooth, 4-5 µm X 2-3 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ906773:

TCCGTTGGTGAACCAGCGGAGGGATCATTACCAGAGTTTTCACAACTCCCAACCCTCCTGTGAACCTACCCATCGTTGCTTCGGCGGACTCGCCCCAGCGTCCGGACGGCCTCGCGCCGGCCCGCGACCTGGACCCAGGCGGCCGCCGGAGACCACGCAACCCTGCATCCATCAGTCTCTCTGAATCCGCCGCAAGGCAACACAAACGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCCGGGACGTCGGCCTTGGGGACCGGCAGCACCCCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGAAGTACTACAGCTCGCACCGGAAACCCGACGCGGCCCCGCCGTGAAACCCCCAACTCTGAACGTTGACCTCGGATCAGGTAGGA-CTACCCGCTGAACTTAAG

 

D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ906768:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCCGTGTGAAGCTCCTTCGAAGAGTCGAGTAGTTTGGGAATGCTGCTCAAAACGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCCATGACCAGACTTGGGCCCGGTGAATCACCCGGCGTTCTCGCCGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGAGAAAGGCTTCGGGAACGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCGCAATACCCTGCGCCGGACTGAGGTACGCGCATCGCAAGGATGCTGGCGTAATGGTCATCAGCGA

Morphology On YM medium at 25°C after 13 days, mycelium white to dingy white, dense, slightly raised forming a mound, velvety. Conidia ellipsoidal to broadly fusiform, smooth, 4-5 µm X 2-3 µm.
Name of Depositor RA Humber
Special Collection ATCC
Chain of Custody
ATCC <-- RA Humber <--AS Martins
Isolation
Popillia japonica (Coleoptera: Scarabaeidae), Terceira Island, Azores, Portugal.
Cross References

Nucleotide (GenBank) : JQ906773 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ906768 D1/D2 region of 28S rRNA gene

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation