Beauveria bassiana (Balsamo) Vuillemin (ATCC® MYA-4886)

Strain Designations: ARSEF 2860  /  Product Format: frozen

Strain Designations ARSEF 2860
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Insect pathogenic fungi
Genome sequencing strain (Zhejiang University, China)
Mitochondrial genome sequenced (Guangdong Forest Institute, Forest Protection, China)
Morphology On YM medium at 25°C after 13 days, mycelium White to dingy white, dense powdery texture. Conidia globose to subglobose, smooth, 2-4 µm X 2-3 µm. 
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ906772:

GTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCTAACCCTTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTAATACAGCTCGCACCGGAACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAG

 

D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ906767:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGCGCCCGGTGAATCACCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTCAGCGCGGGGGAGAAAGGCTTCGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCGTAATGCCCTGCGCCGGACTGAGGTACGCGCATTGCAAGGATGCTGGCGTAATGGTCATCAGCGA

Morphology On YM medium at 25°C after 13 days, mycelium White to dingy white, dense powdery texture. Conidia globose to subglobose, smooth, 2-4 µm X 2-3 µm. 
Name of Depositor RA Humber
Special Collection ATCC
Chain of Custody
ATCC <-- RA Humber <-- MG Feng
Isolation
Diuraphis noxia (Hemiptere: Aphididae), Parma, Idaho, USA.
Cross References

Nucleotide (GenBank) : JQ906772 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ906767 D1/D2 region of 28S rRNA gene