Microascus cirrosus Curzi (ATCC® MYA-4885)

Strain Designations: 70024521  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 70024521
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
clinical isolate
Morphology On potato dextrose medium at 25°C after 13 days, mycelium white to pale pink, very dense, abundant aerial hyphae, velvety to cottony. Conidia ellipsoidal, smooth, 3-5µm X 2-2.5 µm.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ906771:

GTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAAGTTACTCTTCATACCCTTTTGTGAACACTACCCCATTGCCGCGCGTTGCCTCGGCGGGGAGGTCCGCGGGGTTGCGCTCCGGCGCTCCCCCCGGGCCCCCGCCGGCCGCGCCGAACTCTTCATTTGCAAAGCGGACTGTATGTTCTGATTATATCTTGAAAAACAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGCAGCAATCTGCCGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCGAGCGCGGTTCGGCCCCTAGCGGGCCGTCCGCCGCCCGGTGTTGGGGCGCTGCGGGCCCTCGTGCCCGCAGGCCCTGAAATGAAGTGGCGGTCCCGCCGCGGCGCCCCCTGCGTAGTAGTAAAGCACCTCGCATCGGGTCCCGGCGGAGGCCAGCCGTCGAACCTCTTTCTCTTGATGGTTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAAG

 

D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ906766:

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGTCCCCCCGCGGGGCCCGAGTTGTAATTTGAAGAGGATGCTTCTGGCAAGGTGCCGTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTACGGTCGGACGCCGAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCGCCCGTCGGATCAGCCGTCGCTCGTCGGCGGCGCACTCCGGCGGGCTCGGGCCAGCATCAGTTCGCCTCGGGGGGAGAAAGGCGGCGGGAATGTGGCTCTACGGAGTGTTATAGCCCGCCGCGTAATACCCCCGGGCGGACTGAGGACCGCGCGTATGCAAGGATGCTGGCGTAATGGTCGTCAGCGA

Morphology On potato dextrose medium at 25°C after 13 days, mycelium white to pale pink, very dense, abundant aerial hyphae, velvety to cottony. Conidia ellipsoidal, smooth, 3-5µm X 2-2.5 µm.
Name of Depositor F Morio
Special Collection ATCC
Chain of Custody
ATCC <-- F Morio
Isolation
Human, Nantes, France.
Cross References

Nucleotide (GenBank) : JQ906771 ITS including 5.8S rRNA gene

GenBank : JQ906766 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JQ906766 D1/D2 region of 28S rRNA gene

References

Miossec C, et al. Fatal invasive infection with fungemia due to Microascus cirrosus after heart and lung transplantation in a patient with cystic fibrosis. J. Clin. Microbiol. 49: 2743-2747, 2011.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation