Meredithblackwellia eburnea Toome et Aime (ATCC® MYA-4884)

Strain Designations: MCA 4105 [CBS 12589, NRRL Y-48821]  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Microbotryomycetes, Microbotryomycetes incertae sedis, Kriegeriaceae, Meredithblackwellia, eburnea
Strain Designations MCA 4105 [CBS 12589, NRRL Y-48821]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On YM medium at 25°C after 6 days, colonies creamy white to dingy white, smooth, raised, dull, with an entire margin. Cells elongated ellipsoidal, smooth, containing oil droplets, 13.5-16.5 µm X 3-5.25 µm.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ906777:

AAGGATCATTAGTGAATTTTAGGGCGTCGTTTTTAACAACGAGCCTGACCTCCACTTCTAACACTGTGCACTTTGCTTTGGCGCTGAAAACGAGAATTGTTGTGCTTAACGGCCCTTTTTTCAAATGAAGCCCTTAGTCTTTTTTTACTTTAAACATTTGAAGTCAAAGTATGTAACCAAGTTTATAAAACAAAAAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCTCTGGTATTCCGGAGAGCATGTCTGTTTGAGTGTCATGAACTCTTCAACCCTCCAATTTCTAGTAGATTGCGAGGAGTTTGGATTTTGAGCGTTTTGCTAATCTTTAGATTAGCTCGTTCGTAATGCATTAGCCTCTCGAATTCGATTTCGGATTGACTCAGTGTAATAGACTATTCGCTGAGGACACTTTTTACTAAGTGGCCGAATGAGAAACTGTTTAGAAGCTTCTAAAGCAAGTTTGATTAGTCAAATCTTCAATTTAGACCTCAGATCAGGCAGGATTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ906775:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCACTTTCAGTGTCCGAGTTGTAATCTCGAGAAGTGTTTTCCGCGCTAGACTGCATACAAGTCTGTTGGAATACAGCGTCATAGTGGTGAGAACCCCGTACCTGATGCAGATGCCTAGTGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTATCTGGAATTCAGCCGCAAGGCGTATTTTTCAGTTCGCAGGCCAGCATCAGTTTTTGGGGGTGGAAAAGGGTAATTGGAATGTGGCAACTCCGGTTGTGTTATAGCCTTTTACTGGATTCACCTTTGGGGACTGAGGAACGCAGTGTGCTTTTTGCAAGGCCCTCGGGCTTATCACACTTAGGATGCTGGTGGAATGGCTTTAAACGA

Morphology On YM medium at 25°C after 6 days, colonies creamy white to dingy white, smooth, raised, dull, with an entire margin. Cells elongated ellipsoidal, smooth, containing oil droplets, 13.5-16.5 µm X 3-5.25 µm.
Name of Depositor M Toome
Special Collection ATCC
Chain of Custody
ATCC <-- MC Aime, M Toome
Isolation
Fern leaf, Pakaraima Mountains, Guyana.
Cross References

Nucleotide (GenBank) : JQ906777 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ906775 D1/D2 region of 28S rRNA gene

References

Toome M, et al. Meredithblackwellia eburnea gen. et sp. nov., Kriegeriaceae fam. nov. and Kriegeriales ord. nov.—toward resolving higher-level classification in Microbotryomycetes. Mycologia 105: 486–495, 2013. PubMed: 23099516

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation