Cryomyces antarcticus Selbmann et al. (ATCC® MYA-4880™)

Strain Designations: CBS 116301 [CCFEE 534, F44 A812-Hb5]  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations CBS 116301 [CCFEE 534, F44 A812-Hb5]
Biosafety Level 1
Product Format frozen
Type Strain yes
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
meristematic fungus
Morphology On malt extract medium at 20°C after 32 days, Colonies black, raised, with a carbonized, crusty texture. Hyphae dematiaceous, thick walled, closely septate. Conidia globose to subglobose, reddish brown, verrucose to warty texture, produced in long chains, 7.5-10.5µm X 6.75-9µm.
Medium ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 15°C to 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ906770:

AAGGATCATTACCGAGACCGGGTCCAAACGGCCCGACCTCCAACCCTCTGTGTACATACCACGTTGCCTTGGCGGGCCCGCGGGTCCAGTGCCCGCGGCCGGCCCGCGCCGGTCAGCGCCCGCCAGAGGACCTCAAAACTCCGTTCATCAGTGTCGTCCGAGATATGAACTTAAATGAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACACCACTCAAGCACCGCTTGGTATTGGGCCCTCGTCCTCACCCGACGTGCCCCAAAGTCGTCGGCGGCGTCACCTGGCTTCGAGCGCAGTGATCTTTCCATCGCTCTGGAAGCCCCGGTGGCCGTTTGCCAAACAACCCCAAACGCATCAAGGTTGACCTCGGATCAGGCAGGGATACCCGCTGAACTTAAG

 

D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ906765:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCTCGGGGTCCGAGTTGTGATTTGTAGAGGATGCTTCGGGGTCAGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTACGTGACCGGTTGCGCTCCCCATGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCCCGCAGTTGCTCAACCTGTCTTCTGACCGGTGCACTCTTCTGCGGTCAGGCCAGCATCAGTTTGGGCGGCTGGATAAAGGCCCTGGGAACGTGGCTCCCCTCGGGGAGTGTTATAGCCCAGGGTGGAATGCAGCCCGCCCGGACTGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGA
Morphology On malt extract medium at 20°C after 32 days, Colonies black, raised, with a carbonized, crusty texture. Hyphae dematiaceous, thick walled, closely septate. Conidia globose to subglobose, reddish brown, verrucose to warty texture, produced in long chains, 7.5-10.5µm X 6.75-9µm.
Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS <-- L Selbmann
Isolation
Sandstone, Linnaeus Terrace, McMurdo Dry Valley, Southern Victoria Land, Antarctica.
Cross References

Nucleotide (GenBank) : JQ906770 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ906765 D1/D2 region of 28S rRNA gene

References

Selbmann L, et al. Fungi at the edge of life: cryptoendolithic black fungi from Antarctic desert. Stud. Mycol. 51: 1-32, 2005.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS