Malassezia furfur (Robin) Baillon, anamorph (ATCC® MYA-4874)

Strain Designations: M47  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations M47
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Preceptrol® no
Comments
Clinical isolate
Lipophilic, but able to produce small colonies on Sabouraud agar without supplementation of lipids
Morphology On modified Leeming & Notman medium at 34°C after 14 days, colonies buff to tan, raised, smooth to wrinkled, margin lobed. Cells elongated ellipsoidal, smooth, 1.5-6 x 1.5-2.25 µm. Pseudohyphae not observed.
Medium ATCC® Medium 2737: Modified Leeming & Notman Agar (MLNA)
ATCC® Medium 2693: modified Dixon (mDixon)
Growth Conditions
Temperature: 30°C to 34°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ958299:

GGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAGAGCTCAAATTTGAAAGCTGGTACCTCCGGTATCCGCGTTGTAACCTCGAGACACGTTTTCCGTGCGGCGCTATGGACAAGTTCCTTGGAACAGGACATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGATGTACCGTGCTTTGCGATACGTGCTCTAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCGCTTGAAGTCAGCCATGCCGCTCAGGACTCAGCCTGGCTTTTGCTTGGTGTATTTCCTGGGTAGCAAGTCAGCATTGGTTTGGATCGTCGGAGAAGCATAGTCGGAATGTGGCGCCCTCGGGCGTGTTATAGCCTTCTATTGGATACGACGATCTAGACCAAGGAACGCAGCGCGCCTTATGGCGGGTCTTCGGACACCTTCGCGCTTAGGATGCTGGCGTAATGGCTTTAAGTGG

Morphology On modified Leeming & Notman medium at 34°C after 14 days, colonies buff to tan, raised, smooth to wrinkled, margin lobed. Cells elongated ellipsoidal, smooth, 1.5-6 x 1.5-2.25 µm. Pseudohyphae not observed.
Name of Depositor A Zinkeviciene
Special Collection ATCC
Chain of Custody
ATCC <-- A Zinkeviciene
Isolation
Face of patient with atopic dermatitis, Vilnius, Lithuania
Cross References

Nucleotide (GenBank) : JQ958299 D1/D2 region of 28S rRNA gene

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation