Piloderma croceum Eriksson et Hjortstam (ATCC® MYA-4870)

Strain Designations: DSMZ 4824  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Classification Atheliales Atheliaceae Piloderma croceum
Strain Designations DSMZ 4824
Biosafety Level 1
Product Format frozen
Type Strain no
Genome Sequenced Strain

Yes

Comments
Mycorrhizal fungus
Genome sequencing strain (The Joint Genome Institute at the Department of Energy, USA)
Morphology On MMNC medium at 25°C after 36 days, colonies are creamy to dull yellow, velutinous, dense, raised forming a mound (grows denser before spreading out onto plate), slow growing (1.1-1.7 cm after 36 days). Produces a clear to tan exudate. Reverse brown to tan. Hyphae hyline, containing bright yellow particles.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 2798: MMNC Medium
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174048:

TTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAATTATAGGCGAGGGTTGTAGCTGGCCTCTCGGGGCATGTGCACGCCTGAGCCCTTAATCCACACACACCTGTGAACCTATTGTAAGGGCCCGTAAAAAAGGCCTTTACGTCTTATCATCAACCCATCGTATGTCTCATAGAATGTAAATATATGTCCTCGCCTTAAACAGCGTTGATAAACTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTCCGATCGATTTGTTTCGACTTCGGGGCTTGGATTTGGAGCGTGCTGGCGTCGGTCGGCTCCTCTTAAACGCATCAGCGGAATCTAACGTTCCGGACGTCAGTGTGATAATCACGTTGCGCTGTCTTTCGGTCCGAAAAGCCCGCTCACAATGGTCTTCGGACAACTTCATATCAAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174037:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTGCGGCCGTCCGAGTTGTAATCTGGAGAAGCGTTTATCCGCGTCGGACCGTGTACAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACAACCGATGCTTTTGTGATGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGTTTGAAGTCAGTCGCGTCGGCCGAGACTCAACCTGGGCTTCTGCCCGGTGCACTTCTCGGTTGACGGGTCAGCATCAATTTTGACCGCCGGATAAAGGTTGGGGGAATGTGGCATCCTTCGGGATGTGTTATAGACCTCGATTCGGATACGGCGATTGGGATTGAGGAACTCGGCGCTCTGCGTCCAG
Morphology On MMNC medium at 25°C after 36 days, colonies are creamy to dull yellow, velutinous, dense, raised forming a mound (grows denser before spreading out onto plate), slow growing (1.1-1.7 cm after 36 days). Produces a clear to tan exudate. Reverse brown to tan. Hyphae hyline, containing bright yellow particles.
Name of Depositor M Tarkka
Special Collection ATCC
Chain of Custody
ATCC<-- M Tarkka <-- I Kottke <-- JE Nylund
Isolation
Oak (Quercus robur) microcuttings, Uppsala, Sweden.
Geographical Isolation Uppsala
Cross References

Nucleotide (GenBank) : JX174048 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174037 D1/D2 region of 28S rRNA gene

References

Herrmann S, Buscot F. Cross talk at the morphologic, physiological, and gene regulation levels between the mycobiont Piloderma croceum and oak microcuttings (Quercus robur) during formation of ectomycorrhizas. Phytochemistry 68: 52-67, 2007.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation