Malassezia globosa Midgley, E. Guého et J. Guillot (ATCC® MYA-4612)

Strain Designations: CBS 7966 [ATCC 96807, GM 35]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CBS 7966 [ATCC 96807, GM 35]
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Lipophilic or lipid-dependent yeasts.
Genome sequencing strain (The Procter & Gamble Company, USA).
Opportunistic pathogen that can cause systematic infection in neonates and are associated with multiple human skin disorders.
Medium Medium 2737: Modified Leeming & Notman Agar (MLNA)
Medium 2693: modified Dixon (mDixon)
Growth Conditions
Temperature: 30°C to 35°C
Atmosphere: Typical aerobic
Sequenced Data
ITS DNA sequence of MYA-4612

CGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCACCTCCGGTGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGCGGCTCTATGGACAAGTCCCTTGGAATAGGGCATCGTAGAGGGTGAGAATCCCGTACTTGCCATGGAAGAACCGTGCTTTGCGATACACGCTCTAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCACTTGAAGTCAGCCATGCTGCTTGAGACTCAGCCTGGCCTTTGGGCTTGGTGTATTTCTCGGTGGCAAGCCAGCATTGGTTTGGGTCGTCGGAGAAGCGCATAGGGAATGTAGCGTCTCCGGACGTGTTATAGCCTTATGCAGGATACGACGACCTGGATCAAGGAACGCAGTGTGCCCTCTGGGCGGGTCT


D1D2 DNA sequence of MYA-4612

ATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCGTCTTCGGCGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGCGGCTCTATGGACAAGTCCCTTGGAACAGGGCATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGAAGTACCGTGCTTTGTGATACACGCTCCAAGAGTCGAGTAGTTTGGGATTGCTGCTCAAAGTGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCACTTGAAGTCAGCCATGCTGCTTGAGACTCAGCCTGGCTTTTGCTTGGTGTATTTCTCGGTAGCAAGCCAGCATTGGTTTGTGTCGTCGGAGAAGCGTATGGGGAATGTGGCATCCTCGGATGTGTTATAGCCCTGTGCAGGATACGACGACGTAGACCAAGGAACGCAGTGTGCCCTCTGGGCGGGTCTTCGGACACCTTCACACTTAGGA

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS
Isolation
Skin of patient with Pityriasis versicolor, London, UK.
Cross References

Nucleotide (GenBank) : GU291287 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : GU291271 ITS including 5.8S rRNA gene

References

Gueho E, Midgley G, Guillot J. The genus Malassezia with description of four new species. Antonie van Leeuwenhoek 69: 337-355, 1996. PubMed: 8836432

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Xu J, et al. Dandruff-associated Malassezia genomes reveal convergent and divergent virulence traits shared with plant and human fungal pathogens. Proc. Natl. Acad. Sci. USA 104: 18730-18735, 2007. PubMed: 18000048

Kim D, et al. Functional expression and characterization of CYP51 from dandruff-causing Malassezia globosa. FEMS Yeast Res. 11: 80-87, 2011.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation