Malassezia restricta E. Guého, J. Guillot et Midgley (ATCC® MYA-4611)

Strain Designations: CBS 7877 [ATCC 96810, JCM 14890, RA 42.2C, NBRC 103918]  /  Product Format: frozen

Strain Designations CBS 7877 [ATCC 96810, JCM 14890, RA 42.2C, NBRC 103918]
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Lipophilic or lipid-dependent yeasts.
Genome sequencing strain (The Procter & Gamble Company, USA).
Opportunistic pathogen that can cause systematic infection in neonates and are associated with multiple human skin disorders.
Medium ATCC® Medium 2693: modified Dixon (mDixon)
ATCC® Medium 2737: Modified Leeming & Notman Agar (MLNA)
Growth Conditions
Temperature: 30°C
Atmosphere: Typical aerobic
Sequenced Data
ITS DNA sequence of MYA-4611

CAAGGTTTCTGTAGGTGAACCTGCAGAAGGATCATTAGTGAAGATTTGGGCAGGCCATACGGACGCCAAAAAGTGTCCCTGGCCGCCTACACCCACTATACATCCACAAACCCGTGTGCACTGTCTTGGAGAAAGGCTTCAGAGAAGTTTTTTGTGGCCTCTCTTGGGGTCTTTCTTCGCTACAAACTCGAATGGTTAGTATGAACGTGGAACTTGGTTGGACCGTCACTGGCCAACAAACTATACACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTATGGCAATCCGTAGAGCATGCCTGTTTGAGTGCCATGAAATCTCCCACCCCAAGCGGTTTTTACATGAAACGGCTTGGCGGATGGGGTCTGGATGGGTGCCTCTGCCTGCGCTACCTAGCACAGGCTCGCCCGAAATGCATGAGCGCCTTGAGACACTTTGCATCCGCCTCTCTGTTTGGGAGGAGGCGGCCAAGCAGTGTTTTTCTCCTGGCATGGCATGATACGTCATTTGCTATGTCGCCTAAAGGAGGAATGTTTGGTTGTGTCTGCGTGTGCTTCGAACTTGCCTCTGTGGCACATCCCAATT


D1D2 DNA sequence of MYA-4611

ATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCGTCTTCGGCGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGCGGCTCTATGGACAAGTCCCTTGGAACAGGGCATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGAAGTACCGTGCTTTGTGATACACGCTCCAAGAGTCGAGTAGTTTGGGATTGCTGCTCAAAGTGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCACTTGAAGTCAGCCATGCTGCTTGAGACTCAGCCTGGCTTTTGCTTGGTGTATTTCTCGGTAGCAAGCCAGCATTGGTTTGTGTCGTCGGAGAAGCGTATGGGGAATGTGGCATCCTCGGATGTGTTATAGCCCTGTGCAGGATACGACGACGTAGACCAAGGAACGCAGTGTGCCCTCTGGGCGGGTCTTCGGACACCTTCACACTTAGGA

Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS
Isolation
Skin of man, Bristol State, UK.
Cross References

Nucleotide (GenBank) : GU291286 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : GU291270 ITS including 5.8S rRNA gene

References

Gueho E, Midgley G, Guillot J. The genus Malassezia with description of four new species. Antonie van Leeuwenhoek 69: 337-355, 1996. PubMed: 8836432

Xu J, et al. Dandruff-associated Malassezia genomes reveal convergent and divergent virulence traits shared with plant and human fungal pathogens. Proc. Natl. Acad. Sci. USA 104: 18730-18735, 2007. PubMed: 18000048