Aspergillus oryzae (Ahlburg) Cohn, anamorph (ATCC® 42149)

Strain Designations: RIB40  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Aspergillus oryzae var. viridis Murakami, anamorph
Strain Designations RIB40
Application
produces acetamidase
produces acid protease protease (acid)
produces glucoamylase
produces taka-amylase A
Cloning of the taka-amylase A gene
Cloning of the acetamidase gene
Cloning of the acid protease-encoding gene DDBJ D13894
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (National Institute of Technology and Evaluation (NITE), Japan).
Morphology

After 10 days at 25°C colonies growing rapidly, floccose with relatively small conidial structures that originate within the loose aerial mycelium.  Vesicles are small and somewhat elongate; conidia are essentially globose, smooth or nearly so and mostly 4.5 to 5.5 µm in. diameter.

Medium ATCC® Medium 312: Czapek's agar
Growth Conditions
Temperature: 24.0°C
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CACTCTACTTGTGCGCTATCGGTCTCCGGCCAGTATTTAGCTTTAGATGAAATTTACCACCCATTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGAGCTTCACACGGGCGCGGACACCCATCCCAGACGGGATTCTCACCCTCTCTGACGGCCCGTTCCAGGGCACTTAGACAGGGGCCGCACCCGAAGCATCCTCTGCAAATTACAATGCGGACCCCGAAGGAGCCAGCTTTCAAATTTGAGTCTTGCCGCTTCACTCGCCGTTACTGAGGCAATCCCGGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAAAGATTGATTTGGTTCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACGACCCAACACACAGCCGTGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACGGAATTCTGCAATTCACACTAGTTATCGCATTTCCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTCCGGCGGGCGCGGGCCCGGGCTGAGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGTGGGAGGTTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCGCAGGTTCACCTCGGAAACCTTGTTACGA

Morphology

After 10 days at 25°C colonies growing rapidly, floccose with relatively small conidial structures that originate within the loose aerial mycelium.  Vesicles are small and somewhat elongate; conidia are essentially globose, smooth or nearly so and mostly 4.5 to 5.5 µm in. diameter.

Name of Depositor K Nojiro
Chain of Custody
ATCC <<--K Nojiro<<--H. Murakami
Isolation
cereal
Cross References

Nucleotide (GenBank) : D63941 Aspergillus oryzae enoA gene for enolase, complete cds. enolase (= phophopyruvate hydratase) gene, enoA

Nucleotide (GenBank) : E03046 DNA sequence coding for glyceraldehyde-3-phosphate dehydrogenase derived from Aspergillus oryzae.

References

Gomi K, et al. Cloning and nucleotide sequence of the acid protease-encoding gene (pepA) from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 57: 1095-1100, 1993. PubMed: 7763981

Gomi K, et al. Cloning and molecular characterization of the acetamidase-encoding gene (amdS) from Aspergillus oryzae. Gene 108: 91-98, 1991. PubMed: 1840550

Machida M, et al. Molecular cloning of a genomic DNA for enolase from Aspergillus oryzae. Biosci. Biotechnol. Biochem. 60: 161-163, 1996. PubMed: 8824839

. . Agric. Biol. Chem. 53: 593-599, 1989.

. . Agric. Biol. Chem. 56: 207-210, 1992.

Razzaque A, Ueda S. Glucoamylase of Aspergillus oryzae. J. Ferment. Technol. 56: 296-302, 1978.

Machida M, et al. Genome sequencing and analysis of Aspergillus oryzae. Nature 438: 1157-1161, 2005.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Akao T, et al. Analysis of expressed sequence tags from the fungus Aspergillus oryzae cultured under different conditions. DNA Res. 14: 47-57, 2007. PubMed: 17540709

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation