Candida albicans (Robin) Berkhout, anamorph (ATCC® 38289™) Strain Designations: Tu 62823 / Product Format: freeze-dried General Information Characteristics Culture Method Specifications History Documentation Print Email Share Share this product Facebook Twitter Google+ Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. Strain Designations Tu 62823 Biosafety Level 1 Product Format freeze-dried Storage Conditions Frozen: -80°C or colderFreeze-Dried: 2°C to 8°C Type Strain no Morphology After 3 days at 25°C colonies cream-colored, smooth, dull. Yeast-like cells generally globose to short-ovoid, thin-walled, hyaline 2,0-7,0 x 3,0-8,5 µm, usually single or budding, occasionally forming short chains. Pseudohyphae present. Medium ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD Growth Conditions Temperature: 20°C to 25°CAtmosphere: Typical aerobic Sequenced Data D1D2 region of the 28S ribosomal RNA gene:AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTG Morphology After 3 days at 25°C colonies cream-colored, smooth, dull. Yeast-like cells generally globose to short-ovoid, thin-walled, hyaline 2,0-7,0 x 3,0-8,5 µm, usually single or budding, occasionally forming short chains. Pseudohyphae present. Name of Depositor V Hopsu-Havu Isolation Female urethra Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. Basic Documentation Product Sheet Certificate of Analysis MSDS Other Documentation Microbial Characterization Data