Penicillium rubens Biourge (ATCC® 28089)

Strain Designations: WIS 54-1255 [Wis. 51-20; Wis. 48-70; NRRL 1951; ATCC 9480]  /  Product Format: freeze-dried

Deposited As Penicillium chrysogenum Thom, anamorph
Strain Designations WIS 54-1255 [Wis. 51-20; Wis. 48-70; NRRL 1951; ATCC 9480]
Application
produces acyl-CoA-6-aminopenicillanic acid acyltransferase
produces isopenicillin N synthetase
produces penicillin
produces penicillin V
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
High penicillin producer
Phenylacetic acid transport system
Genome sequencing strain (DSM Anti-Infectives, The Netherlands).
The strain was reclassified as Penicillium rubens based on a recent molecular phylogenetic study. RefHoubraken J, et al. New penicillin-producing Penicillium species and an overview of section Chrysogena. Persoonia 29: 78-100, 2012. PubMed: 23606767
Morphology After 5-6 days at 25°C on potato dextrose medium colonies growing rapidly, velutinous to floccose. Conidiophore stipes smooth-walled, 200-300 µm long; penicilli usually terverticillate. Metulae 8-12 µm long. Phialides flask-shaped, 7-10 µm long. Conidia smooth-walled, ellipsoidal, 2.5-4.0 µm long, blue or bluish-green.
Medium Medium 200: YM agar or YM broth
Medium 325: Malt extract agar (Blakeslee's formula)
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGTAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAACGAC

Morphology After 5-6 days at 25°C on potato dextrose medium colonies growing rapidly, velutinous to floccose. Conidiophore stipes smooth-walled, 200-300 µm long; penicilli usually terverticillate. Metulae 8-12 µm long. Phialides flask-shaped, 7-10 µm long. Conidia smooth-walled, ellipsoidal, 2.5-4.0 µm long, blue or bluish-green.
Name of Depositor CY O'Sullivan
Chain of Custody
ATCC <-- CY O'Sullivan <-- Wis. 51-20 <-- Wis. 48-70 <-- NRRL 1951
References

O'Sullivan CY, Pirt SJ. Penicillin production by lysine auxotrophs of Penicillium chrysogenum. J. Gen. Microbiol. 76: 65-75, 1973. PubMed: 4198715

Luengo JM, et al. Direct enzymatic synthesis of penicillin G using cyclases of Penicillium chrysogenum and Acremonium chrysogenum. Bio-Technology 4: 44-47, 1986.

Ramsay BA, et al. Penicillin production in an inverse fluidized bed bioreactor. J. Ferment. Bioeng. 72: 495-497, 1991.

Ferrero MA, et al. Biosynthesis of benzylpenicillin (G), phenoxymethylpenicillin (V) and octanoylpenicillin (K) from glutathione S-derivatives. J. Antibiot. 43: 684-691, 1990. PubMed: 2166024

Martin-Villacorta J, et al. Acyl-CoA: 6-APA acyltransferase from Penicillium chrysogenum studies on its hydrolytic activity. J. Antibiot. 44: 108-110, 1991. PubMed: 1848214

Ferrero MA, et al. In vitro enzymatic synthesis of new penicillins containing keto acids as side chains. Antimicrob. Agents Chemother. 35: 1931-1932, 1991. PubMed: 1952871

Alonso MJ, et al. Enzymatic synthesis of penicillins. J. Antibiot. 41: 1074-1084, 1988. PubMed: 3170343

Fernandez-Canon JM, et al. Uptake of phenylacetic acid by Penicillium chrysogenum Wis 54-1255: a critical regulatory point in benzylpenicillin biosynthesis. J. Antibiot. 42: 1398-1409, 1989. PubMed: 2507493

Fernandez-Canon JM, et al. Phenylacetic acid transport system in Penicillium chrysogenum Wis 54- 1255: molecular specificity of its induction. J. Antibiot. 42: 1410-1415, 1989. PubMed: 2507494

Martinez-Blanco H, et al. Repression of phenylacetic acid transport system in Penicillium chrysogenum Wis 54-1255 by free amino acids and ammonium salts. J. Antibiot. 42: 1416-1423, 1989. PubMed: 2507495

MacDonald KD, et al. Properties of heterozygous diploids between strains of Penicillium chrysogenum selected for high penicillin yield. Antonie van Leeuwenhoek 30: 209-224, 1964.

Xu Z, et al. Genome physical mapping from large-insert clones by fingerprint analysis with capillary electrophoresis: a robust physical map of Penicillium chrysogenum. Nucleic Acids Res. 33: e50, 2005. PubMed: 15767275

van den Berg MA, et al. Genome sequencing and analysis of the filamentous fungus Penicillium chrysogenum. Nat. Biotechnol. 26:1161-1168, 2008. PubMed: 18820685

Houbraken J, et al. New penicillin-producing Penicillium species and an overview of section Chrysogena. Persoonia 29: 78-100, 2012. PubMed: 23606767