Cryptococcus laurentii (Kufferath) Skinner, anamorph (ATCC® 18803)

Strain Designations: CBS 139 [CCRC 20527, CCY 17-3-2, DBVPG 6265, IFO 0609, IFO 0906, MUCL 30398, NRRL Y-2536, VKM Y-1665, VKPM Y-219]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations CBS 139 [CCRC 20527, CCY 17-3-2, DBVPG 6265, IFO 0609, IFO 0906, MUCL 30398, NRRL Y-2536, VKM Y-1665, VKPM Y-219]
Application
Produces xylan endo-1,3-beta-xylosidase xylan hydrolase, xylanase
Quality control strain
Quality control strain for API products
Control strain for identification
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® yes
Comments
Alkali-tolerant at pH 10
Morphology On YM medium at 25°C after 7 days, colonies creamy white to dingy white, raised, smooth, margin entire. Cells subglobose to ellipsoidal, smooth, hyaline, 6-8 X 3-6 µm. Pseudohyphae not observed.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAAAGATTGACCGAAAGGTCTTATCTCTATATCCCTCACCTCTGTGAACTGTGGACCTCCGGGTCTGTCTTAACAAACATCAGTGTAATGAACGTATAAATCATTAAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAATCCCCCCGGGTTTATGATCTGGTCGGGACTTGGACATGGGCGTCTGCCGGTCACACGGCTCGCCTCAAATGACTTAGTGGATCTCTCTGCATCCGTGACAGACGTAATAAGTTTCGTCTTGTCCCTTGCGTACGAGTCCGCTCATAACCTGCCATCGCGCACTTTAGACTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCAGGGCGTCCGAGTTGTAATCTATAGAGGCGTTTTCCGTGCCGGACCGTGTCCAAGTTCCTTGGAACAGGATATCAAAGAGGGTGACAATCCCGTACTTGACACGACGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGACCGAGAGGCTCAGCCGGTTCTGCCGGTGTATTCCCCTCGGTCGGGTCAACATCAGTTTTGTCCGGTGGATAAGGACGGTAGGAAGGTGGCACCCTCGGGTGTGTTATAGCCTGCCGTCGCATACATCGGGTGAGACTGAGGAACGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTTGACATAATGGCTTTAAACGA

Morphology On YM medium at 25°C after 7 days, colonies creamy white to dingy white, raised, smooth, margin entire. Cells subglobose to ellipsoidal, smooth, hyaline, 6-8 X 3-6 µm. Pseudohyphae not observed.
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- H Kufferath
Isolation
Palm wine, malaffou, Congo
Cross References

Nucleotide (GenBank) : AF075469 Cryptococcus laurentii 26S ribosomal RNA gene, partial sequence.

Nucleotide (GenBank) : AF218974 Cryptococcus laurentii strain ATCC 18803T 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequnece; 28S ribosomal RNA gene, partial sequence.

References

Sutherland ES, et al. Production of double stranded ribonucleic acid. US Patent 3,597,318 dated Aug 3 1971

Kufferath H. Peut-on obtenir du mout de biere alcalin?. Ann. Bull. Seances Soc. R. Sci. Med. Nat. Bruxelles 74: 16-46, 1920.

Biely P, et al. Xylan-degrading activity in yeasts: growth on xylose, xylan and hemicelluloses. Folia Microbiol. 23: 366-371, 1978.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Aono R. Taxonomic distribution of alkali-tolerant yeasts. Syst. Appl. Microbiol. 13: 394-397, 1990.

API 20C AUX. bioMerieux.

McTaggart LR, et al. Rapid identification of Cryptococcus neoformans and Cryptococcus gattii by matrix-assisted laser desorption ionization-time of flight mass spectrometry. J. Clin. Microbiol. 49: 3050-3053, 2011. PubMed: 21653762

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation