Candida glabrata (Anderson) Meyer et Yarrow (ATCC® 15545)

Strain Designations: NRRL YB-4025 [ATCC 34972]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Torulopsis glabrata (Anderson) Lodder et de Vries
Strain Designations NRRL YB-4025 [ATCC 34972]
Application
Assimilates ethyl alcohol ethanol
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GATCATTAAAGAAATTTAATTGATTTGTCTGAGCTCGGAGAGAGACATCTCTGGGGAGGACCAGTGTAGACACTCAGGAGGCTCCTAAAATATTTTCTCTGCTGTGAATGCTATTTCTCCTGCCTGCGCTTAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCAAAGGAGGTGTTTTATCACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTTCGTTGGGGGAACGCTCTCTTTCGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAAATATTTTTTTAAACTAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACTTTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACGTTGTGTTTGGTAGTGAGTGATACTCTCGTTTTTGAGTTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAGGGAGGGATATGTGAGTGTTCTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAA

Name of Depositor NRRL
Isolation
Young woman with fatal septicemia
Cross References

Nucleotide (GenBank) : AF167993 Candida glabrata internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

References

Mehta RJ. Pyridine nucleotide-linked oxidation of methanol in methanol-assimilating yeasts. J. Bacteriol. 124: 1165-1167, 1975. PubMed: 361

Mehta RJ. Demonstration of methanol dehydrogenase in methanol assimilating yeasts. Experientia 31: 407-408, 1975. PubMed: 164367

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation