Malassezia pachydermatis (Wiedman) Dodge, anamorph (ATCC® 14522)

Strain Designations: CBS 1879 [238 Shesis, CCRC 21676, IFO 10064, NRRL Y-17165]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Pityrosporum canis Gustafson, anamorph
Strain Designations CBS 1879 [238 Shesis, CCRC 21676, IFO 10064, NRRL Y-17165]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology After 15 days on Emmons’ modification of Sabouraud’s medium at 37°C, colonies are cream-colored, smooth, and soft. Yeast cells are ovoid, single, in pairs or clusters.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ATCGTAACAAGGTTTCTGTAGGTGAACCTGCAGAAGGATCATTAGTGAATTTGTAGGGCCTGCCATACGGATGCGCAAGCGTCTCTGGCGCCCAACCCACTATACATCCACAAACCCGTGTGCACTTGTGTTGCTTTGGCCTGTATGGGCGAGCGCACGCATTCAAACAAACTCGTATGGTTGTATGTACGTTGTAAACGTTGGACCGTCACTGGCCAACAAACTTTATACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGCCGCGAATTCTCCCACCCCAAACGGTTGCCGAAAGGTACTGTGCGGCGGAGGGGTTGGATGGGTGCTACTGCCTGTGGTGGGGAAACTACAACAGGCTCGCCCGAAATGCATTAGCGCCTCAGGACACATTCGCTACTGCTCTACAAAAGGAAGAGCAGCGAAGCGTATGGGGGGGAAAACCACCACCGGTTATTCCAAACCTCGCCTGACTGTTTTTGCGCGCATGGCATGATACGTCATTTGCTGTGTTGCGTAGGTTGGTGCGTGGGACTGTGTGAGTGCCTCTAGAGCTTTGAGAAGTGTGTTTCGTGTGCTACGAACTGAAAAAGTACATTCCTTTTTTTCAATTCTGGTCTCAAATCAGGTAGGATCACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene.

GTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAGAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCACCTTCGGTGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGTGGCGCTATGGACAAGTCCCTTGGAACAGGGCATCGTAGAGGGTGAAAATCCCGTACTTGCCATGGCTGTACCATGCTTTGTGATACACGCTCTAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCGCTTGAAGTCAGCCATGCTGCTTGAGACTCAGCCTTGCTTTTGCTTGGTGTATTTCTCGGTAGCAAGCCAGCATTGGTTCGAGTCGTCGGAGAAGGGTATGAGAAATGTGGCATCCTCGGATGTGTTATAGACTTGTACTGGATACGACGATTTGGATCAAGGAACGCAGTGTGCCTCTGGCGGGTCTTCGGACACCTTCACACTTAGGATGCTGGCGTAATGGCTTTAAGCGGCCCGTCTTG

Morphology After 15 days on Emmons’ modification of Sabouraud’s medium at 37°C, colonies are cream-colored, smooth, and soft. Yeast cells are ovoid, single, in pairs or clusters.
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- BA Gustafson 238 Shesis
Isolation
Otitis externa in a dog, Sweden
Cross References

Nucleotide (GenBank) : AF063215 26S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : AJ249952 26S ribosomal RNA gene, partial sequence

References

Lodder J. The yeasts: a taxonomic study. 2nd ed. Amsterdam: North-Holland; 1970.

Guillot J, Gueho E. The diversity of Malassezia yeasts confirmed by rRNA sequence and nuclear DNA comparisons. Antonie van Leeuwenhoek 67: 297-314, 1995. PubMed: 7778898

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation